Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU071641

Sigma-Aldrich

MISSION® esiRNA

targeting human AQP3

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GACAGAAGGAGCTGGTGTCCCGCTGCGGGGAGATGCTCCACATCCGCTACCGGCTGCTCCGACAGGCGCTGGCCGAGTGCCTGGGGACCCTCATCCTGGTGATGTTTGGCTGTGGCTCCGTGGCCCAGGTTGTGCTCAGCCGGGGCACCCACGGTGGTTTCCTCACCATCAACCTGGCCTTTGGCTTTGCTGTCACTCTGGGCATCCTCATCGCTGGCCAGGTCTCTGGGGCCCACCTGAACCCTGCCGTGACCTTTGCCATGTGCTTCCTGGCTCGTGAGCCCTGGATCAAGCTGCCCATCTACACCCTGGCACAGACGCTGGGAGCCTTCTTGGGTGCTGGAATAGTTTTTGGGCTGTATTATGATGCAATCTGGCACTTCGCCGACAACCAGCTTTTTGTTTCGGGCCCCAATGGCACAGCCGGCATCTTTGCTACCTACCCCTCTGGA

Ensembl | Número de adesão de ser humano

ENSG00000165272

nº de adesão NCBI

NM_004925

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... AQP3(360) , AQP3(360)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Mariko Hara-Chikuma et al.
Biochemical and biophysical research communications, 471(4), 603-609 (2016-02-21)
Aquaporin 3 (AQP3), a water/glycerol channel protein, is capable of transporting hydrogen peroxide (H2O2). Here, we show that AQP3-mediated intracellular H2O2 is involved in epidermal growth factor (EGF)-induced cell signaling and its dependent cell function in the EGF receptor (EGFR)-positive
Hiroki Satooka et al.
Molecular and cellular biology, 36(7), 1206-1218 (2016-02-03)
Most breast cancer mortality is due to clinical relapse associated with metastasis. CXCL12/CXCR4-dependent cell migration is a critical process in breast cancer progression; however, its underlying mechanism remains to be elucidated. Here, we show that the water/glycerol channel protein aquaporin-3
Ya-Jing Tan et al.
Scientific reports, 5, 17741-17741 (2015-12-05)
Hyperosmotic stress may induce apoptosis of different cells. However, oocytes show tolerance to osmotic stress during cryopreservation by vitrification, which is an assisted reproductive technique. The underlying mechanism is still not understood. Here, we demonstrated that hyperosmosis produced by high
Xiaoyong Wang et al.
Molecular medicine reports, 16(2), 1964-1972 (2017-06-29)
Aquaporin 3 (AQP3) and phospholipase D2 (PLD2) are abnormally expressed and/or localized in squamous cell carcinoma (SCC). AQP3 transports glycerol to PLD2 for the synthesis of lipid second messenger, which can mediate the effect of the AQP3/PLD2 signaling module in
Dieanira Erudaitius et al.
PloS one, 12(1), e0170442-e0170442 (2017-01-21)
Cancer cell toxicity to therapeutic H2O2 varies widely depending on cell type. Interestingly, it has been observed that different cancer cell types have varying peroxiporin expression. We hypothesize that variation in peroxiporin expression can alter cell susceptibility to therapeutic H2O2
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica