Todas as fotos(1)

Key Documents

COO/COA

EHU070611

MISSION^® esiRNA

Name: MISSION<SUP>®</SUP> esiRNA
Brand: SIGMA

targeting human RBBP8

Faça loginpara ver os preços organizacionais e de contrato

Todas as fotos(1)

About This Item

Código UNSPSC:

41105324

NACRES:

NA.51

descrição

linha de produto

MISSION^®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

ACCCCCATGTCCGATACATAGAACAAACACATACTAAATTGGAGCACTCTGTGTGTGCAAATGAAATGAGAAAAGTTTCCAAGTCTTCAACTCATCCACAACATAATCCTAATGAAAATGAAATTCTAGTAGCTGACACTTATGACCAAAGTCAATCTCCAATGGCCAAAGCACATGGAACAAGCAGCTATACCCCTGATAAGTCATCTTTTAATTTAGCTACAGTTGTTGCTGAAACACTTGGACTTGGTGTTCAAGAAGAATCTGAAACTCAAGGTCCCATGAGCCCCCTTGGTGATGAGCTCTACCACTGTCTGGAAGGAAATCACAAGAAACAGCCTTTTGAGGAATCTACAAGAAATACTGAAGATAGTTTAAGATTTTCAGATTCTACTTCAAAGACTCCTCCTCAAGAAGAATTACCTACTCGAGTGTCATCTCCTGTATTTGGAGC

Ensembl | Número de adesão de ser humano

ENSG00000101773

nº de adesão NCBI

NM_203292

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... RBBP8(5932) , RBBP8(5932)

Categorias relacionadas

MISSION® esiRNA

Descrição geral

MISSION^® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

DNA end resection requires constitutive sumoylation of CtIP by CBX4.

Isabel Soria-Bretones et al.

Nature communications, 8(1), 113-113 (2017-07-26)

DNA breaks are complex DNA lesions that can be repaired by two alternative mechanisms: non-homologous end-joining and homologous recombination. The decision between them depends on the activation of the DNA resection machinery, which blocks non-homologous end-joining and stimulates recombination. On

The DNA-Binding Polyamine Moiety in the Vectorized DNA Topoisomerase II Inhibitor F14512 Alters Reparability of the Consequent Enzyme-Linked DNA Double-Strand Breaks.

Oriane Bombarde et al.

Molecular cancer therapeutics, 16(10), 2166-2177 (2017-06-15)

Poisons of topoisomerase II (TOP2) kill cancer cells by preventing religation of intermediate DNA breaks during the enzymatic process and thus by accumulating enzyme-drug-DNA complexes called TOP2 cleavage-complex (TOP2cc). F14512 is a highly cytotoxic polyamine-vectorized TOP2 inhibitor derived from etoposide

SUMOylation of E2F1 Regulates Expression of EZH2.

Li Du et al.

Cancer research, 80(19), 4212-4223 (2020-08-21)

Elevated expression of EZH2, the enzymatic subunit of polycomb repressive complex 2 (PRC2), often occurs in cancer. EZH2 expression results in the silencing of genes that suppress tumor formation and metastasis through trimethylation of histone H3 at lysine 27 (H3K27me3)

PARPi Triggers the STING-Dependent Immune Response and Enhances the Therapeutic Efficacy of Immune Checkpoint Blockade Independent of BRCAness.

Jianfeng Shen et al.

Cancer research, 79(2), 311-319 (2018-11-30)

PARP inhibitors (PARPi) have shown remarkable therapeutic efficacy against BRCA1/2-mutant cancers through a synthetic lethal interaction. PARPi exert their therapeutic effects mainly through the blockade of ssDNA damage repair, which leads to the accumulation of toxic DNA double-strand breaks specifically

Characterization of the loss of SUMO pathway function on cancer cells and tumor proliferation.

Xingyue He et al.

PloS one, 10(4), e0123882-e0123882 (2015-04-11)

SUMOylation is a post-translational ubiquitin-like protein modification pathway that regulates important cellular processes including chromosome structure, kinetochore function, chromosome segregation, nuclear and sub-nuclear organization, transcription and DNA damage repair. There is increasing evidence that the SUMO pathway is dysregulated in

Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica