Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU069501

Sigma-Aldrich

MISSION® esiRNA

targeting human SMAD2 (2)

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATTGAGCCACAGAGTAATTATATTCCAGAAACGCCACCTCCTGGATATATCAGTGAAGATGGAGAAACAAGTGACCAACAGTTGAATCAAAGTATGGACACAGGCTCTCCAGCAGAACTATCTCCTACTACTCTTTCCCCTGTTAATCATAGCTTGGATTTACAGCCAGTTACTTACTCAGAACCTGCATTTTGGTGTTCGATAGCATATTATGAATTAAATCAGAGGGTTGGAGAAACCTTCCATGCATCACAGCCCTCACTCACTGTAGATGGCTTTACAGACCCATCAAATTCAGAGAGGTTCTGCTTAGGTTTACTCTCCAATGTTAACCGAAATGCCACGGTAGAAAT

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Ping Zhao et al.
Cancer chemotherapy and pharmacology, 84(2), 427-439 (2019-05-16)
Although DNA-mismatch-repair-deficient (dMMR) status and aberrant expression of miRNAs are both critically implicated in the pathogenesis of resistance to 5-fluorouracil (5-FU) in colorectal cancer (CRC), whether these two factors regulate tumor response to 5-FU in a coordinated manner remains unknown.
Qingde Wa et al.
Oncology reports, 39(1), 81-90 (2017-11-16)
Constitutive activation of TGF‑β signaling pathway is a well-documented mechanism responsible for the bone metastasis of prostate cancer (PCa). MicroRNAs (miRNAs) have been reported to be crucial for the activation of TGF‑β signaling via targeting downstream components of TGF‑β signaling
Wei Zhang et al.
Journal of Cancer, 12(6), 1678-1686 (2021-02-23)
Circular RNAs (circRNAs) are associated with various diseases, including cancers. However, their roles in colorectal cancer (CRC) have not been established. Hsa_circ_0000847 (circ_SMAD2) is a novel circRNA that was found to be elevated in CRC cell lines and tissues. High
Benjamin V Park et al.
Cancer discovery, 6(12), 1366-1381 (2016-09-30)
Programmed death-1 (PD-1) is a coinhibitory receptor that downregulates the activity of tumor-infiltrating lymphocytes (TIL) in cancer and of virus-specific T cells in chronic infection. The molecular mechanisms driving high PD-1 expression on TILs have not been fully investigated. We
Ayesha Ghayur et al.
American journal of physiology. Renal physiology, 317(1), F152-F162 (2019-05-30)
Glomerulonephritis (GN) is a common cause of end-stage kidney disease and is characterized by glomerular inflammation, hematuria, proteinuria, and progressive renal dysfunction. Transforming growth factor (TGF)-β is involved in glomerulosclerosis and interstitial fibrosis. TGF-β activates multiple signaling pathways, including the

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica