Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU069091

Sigma-Aldrich

MISSION® esiRNA

targeting human ATP2A2

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CTGGACAGAGTGGAAGGTGATACTTGTTCCCTTAATGAGTTTACCATAACTGGATCAACTTATGCACCTATTGGAGAAGTGCATAAAGATGATAAACCAGTGAATTGTCACCAGTATGATGGTCTGGTAGAATTAGCAACAATTTGTGCTCTTTGTAATGACTCTGCTTTGGATTACAATGAGGCAAAGGGTGTGTATGAAAAAGTTGGAGAAGCTACAGAGACTGCTCTCACTTGCCTAGTAGAGAAGATGAATGTATTTGATACCGAATTGAAGGGTCTTTCTAAAATAGAACGTGCAAATGCCTGCAACTCAGTCATTAAACAGCTGATGAAAAAGGAATTCACTCTAGAGTTTTCACGTGACAGAAAGTCAATGTCGGTTTACTGTACACCAAATAAACCAAGCAGGA

Ensembl | Número de adesão de ser humano

ENSG00000174437

nº de adesão NCBI

NM_170665

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... ATP2A2(488) , ATP2A2(488)

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Cheol Yi Hong et al.
Experimental & molecular medicine, 48(8), e253-e253 (2016-08-20)
The migration of dendritic cells (DCs) to secondary lymphoid organs depends on chemoattraction through the interaction of the chemokine receptors with chemokines. However, the mechanism of how lymphoid chemokines attract DCs to lymphoid organs remains unclear. Here, we demonstrate the
Jie Tong et al.
Biochimica et biophysica acta, 1864(12), 2389-2401 (2017-10-01)
The mechanism by which cell shape regulates the function of the cell is one of the most important biological issues, but it remains unclear. Here, we investigated the effect of the regulation of cell shape on proliferation by using a
Eduardo Izquierdo-Torres et al.
Molecular carcinogenesis, 56(7), 1703-1711 (2017-02-06)
The Ca
Feng Huang et al.
Journal of cancer research and clinical oncology, 140(11), 1835-1848 (2014-06-19)
This study was designed to investigate the role of PDGF-DD secreted by gastric cancer-derived mesenchymal stem cells (GC-MSCs) in human gastric cancer progression. Gastric cancer cells were indirectly co-cultured with GC-MSCs in a transwell system. The growth and migration of

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica