Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU068851

Sigma-Aldrich

MISSION® esiRNA

targeting human ASAP1

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CTTGAGGCCATCAAATCCAGGGATTTACTTGCACTAATTCAAGTCTATGCAGAAGGGGTAGAGCTAATGGAACCACTGCTGGAACCTGGGCAGGAGCTTGGGGAGACAGCCCTTCACCTTGCCGTCCGAACTGCAGATCAGACATCTCTCCATTTGGTTGACTTCCTTGTACAAAACTGTGGGAACCTGGATAAGCAGACGGCCCTGGGAAACACAGTTCTACACTACTGTAGTATGTACAGTAAACCTGAGTGTTTGAAGCTTTTGCTCAGGAGCAAGCCCACTGTGGATATAGTTAACCAGGCTGGAGAAACTGCCCTAGACATAGCAAAGAGACTAAAAGCTACCCAGTGTGAAGATCTGCTTTCCCAGGCTAAATCTGGAAAGTTCAATCCACACGTCCACGTAGAAT

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Jia Cui et al.
Frontiers in cellular and infection microbiology, 10, 519503-519503 (2020-11-17)
The ADP ribosylation factor (ARF) GTPase activation protein ASAP1 possesses multiple biological functions, including regulation of cytoskeletal dynamics, small GTP-binding protein receptor recycling, and intracellular vesicle trafficking. Recently, ASAP1 polymorphisms have been reported to be associated with human susceptibility to
Anjelika Gasilina et al.
iScience, 22, 166-180 (2019-12-01)
ASAP1 is a multi-domain ArfGAP that controls cell migration, spreading, and focal adhesion dynamics. Although its GAP activity contributes to remodeling of the actin cytoskeleton, it does not fully explain all cellular functions of ASAP1. Here we find that ASAP1
Sheroy Minocherhomji et al.
Nature, 528(7581), 286-290 (2015-12-04)
Oncogene-induced DNA replication stress has been implicated as a driver of tumorigenesis. Many chromosomal rearrangements characteristic of human cancers originate from specific regions of the genome called common fragile sites (CFSs). CFSs are difficult-to-replicate loci that manifest as gaps or

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica