Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU068161

Sigma-Aldrich

MISSION® esiRNA

targeting human CD47

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GGCCTCTGGCCTCTAGGTAACCAGTTTAAATTGGTTCAGGGTGATAACTACTTAGCACTGCCCTGGTGATTACCCAGAGATATCTATGAAAACCAGTGGCTTCCATCAAACCTTTGCCAACTCAGGTTCACAGCAGCTTTGGGCAGTTATGGCAGTATGGCATTAGCTGAGAGGTGTCTGCCACTTCTGGGTCAATGGAATAATAAATTAAGTACAGGCAGGAATTTGGTTGGGAGCATCTTGTATGATCTCCGTATGATGTGATATTGATGGAGATAGTGGTCCTCATTCTTGGGGGTTGCCATTCCCACATTCCCCCTTCAACAAACAGTGTAACAGGTCCTTCCCAGATTTAGGGTACTTTTATTGATGGATATGTTTTCCTTTTATTCACATAACCCCTTGAAACCCTG

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Xifu Song et al.
Experimental and therapeutic medicine, 20(4), 3301-3309 (2020-08-29)
Treatment with cluster of differentiation 47 (CD47) monoclonal antibody has exhibited promising antitumor effects in various preclinical cancer models. However, its role in pancreatic ductal adenocarcinoma (PDAC) remains unclear. In the present study, the CD47 expression level was measured in
Xuejian Liu et al.
Oncology research, 27(4), 415-422 (2018-01-13)
Cluster of differentiation 47 (CD47) overexpression is common in various malignancies. This study investigated whether CD47 promotes human glioblastoma invasion and, if so, the underlying mechanisms involved. CD47 expression was found to be stronger in tissues of patients with glioblastoma
Natasha M Rogers et al.
Kidney international, 90(2), 334-347 (2016-06-05)
Defects in renal tubular epithelial cell repair contribute to renal ischemia reperfusion injury, cause acute kidney damage, and promote chronic renal disease. The matricellular protein thrombospondin-1 and its receptor CD47 are involved in experimental renal ischemia reperfusion injury, although the
Hui Zhao et al.
Scientific reports, 6, 29719-29719 (2016-07-15)
CD47 is overexpressed in many human cancers, its level positively correlates with tumor invasion and metastasis. However, it is largely unknown whether CD47 overexpression drives metastasis and how CD47 lead to tumor metastasis in non-small cell lung cancer (NSCLC). In
Thies Rösner et al.
Molecular cancer therapeutics, 18(1), 75-88 (2018-10-05)
Three FDA-approved epidermal growth factor receptor (EGFR) antibodies (cetuximab, panitumumab, necitumumab) are clinically available to treat patients with different types of cancers. Interestingly, panitumumab is of human IgG2 isotype, which is often considered to have limited immune effector functions. Unexpectedly

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica