Todas as fotos(1)

Key Documents

EHU068071

MISSION^® esiRNA

Name: MISSION<SUP>®</SUP> esiRNA
Brand: SIGMA

targeting human SLC8A3

Faça loginpara ver os preços organizacionais e de contrato

Todas as fotos(1)

About This Item

Código UNSPSC:

41105324

NACRES:

NA.51

descrição

linha de produto

MISSION^®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GACCGCTTCATGGCATCTATTGAAGTCATCACCTCTCAAGAGAGGGAGGTGACAATTAAGAAACCCAATGGAGAAACCAGCACAACCACTATTCGGGTCTGGAATGAAACTGTCTCCAACCTGACCCTTATGGCCCTGGGTTCCTCTGCTCCTGAGATACTCCTCTCTTTAATTGAGGTGTGTGGTCATGGGTTCATTGCTGGTGATCTGGGACCTTCTACCATTGTAGGGAGTGCAGCCTTCAACATGTTCATCATCATTGGCATCTGTGTCTACGTGATCCCAGACGGAGAGACTCGCAAGATCAAGCATCTACGAGTCTTCTTCATCACCGCTGCTTGGAGTATCTTTGCCTACATCTGGCTCTATATGATTCTGGCAGTCTTCTCCCCTGGTGTGGTCCAGGTTTGGGAAGGCCTCCTCACTCTCTTCTTCTTTCCAGTGTGTGTCCTTCTGGCCT

Ensembl | Número de adesão de ser humano

ENSG00000100678

nº de adesão NCBI

NM_033262

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... SLC8A3(6547) , SLC8A3(6547)

Categorias relacionadas

MISSION® esiRNA

Oligos, qPCR Probes & Peptides

Descrição geral

MISSION^® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Selective inhibition of mitochondrial sodium-calcium exchanger protects striatal neurons from α-synuclein plus rotenone induced toxicity.

Guendalina Bastioli et al.

Cell death & disease, 10(2), 80-80 (2019-01-30)

Progressive accumulation of α-synuclein (α-syn) and exposure to environmental toxins are risk factors that may both concur to Parkinson's disease (PD) pathogenesis. Electrophysiological recordings of field postsynaptic potentials (fEPSPs) and Ca2+ measures in striatal brain slices and differentiated SH-SY5Y cells

Glutamate as a potential "survival factor" in an in vitro model of neuronal hypoxia/reoxygenation injury: leading role of the Na+/Ca2+ exchanger.

Silvia Piccirillo et al.

Cell death & disease, 9(7), 731-731 (2018-06-30)

In brain ischemia, reduction in oxygen and substrates affects mitochondrial respiratory chain and aerobic metabolism, culminating in ATP production impairment, ionic imbalance, and cell death. The restoration of blood flow and reoxygenation are frequently associated with exacerbation of tissue injury

Tumor necrosis factor-related apoptosis-inducing ligand reduces the expression of the neuroprotective Na+ /Ca2+ exchanger isoform NCX3 in human neuroblastoma SH-SY5Y cells.

Giulia Di Benedetto et al.

The FEBS journal, 286(4), 737-749 (2018-12-16)

Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL), a cytokine belonging to the TNF superfamily, is regarded as a mediator of neurotoxicity. The constitutively expressed ion exchanger Na+ /Ca2+ exchanger isoform-3 (NCX3) has been shown to protect neurons from injury. Its expression

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica