Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU067731

Sigma-Aldrich

MISSION® esiRNA

targeting human HUWE1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CATCTTGGGCAAGTCAGTCAGATATACAGATATGGAGAGTGAAGATTACCACTTCTACCAAGGTCTGGTTTATCTGCTGGAAAATGATGTCTCCACACTAGGCTATGACCTCACCTTCAGCACTGAGGTCCAAGAGTTTGGAGTTTGTGAAGTTCGTGACCTCAAACCCAATGGGGCCAACATCTTGGTAACAGAGGAGAATAAGAAGGAGTATGTACACCTGGTATGCCAGATGAGAATGACAGGAGCCATCCGCAAGCAGTTGGCGGCTTTCTTAGAAGGCTTCTATGAGATCATTCCAAAGCGCCTCATTTCCATCTTCACTGAGCAGGAGTTAGAGCTGCTTATATCAGGACTGCCCACCATTGACATCGATGATCTGAAATCCAACACTGAATACCACAAGTACCAGTCCAACTCTATTCAGATCCAGTGGTTCTGGAGAGCATTGCGTTCTTTC

Ensembl | Número de adesão de ser humano

ENSG00000086758

nº de adesão NCBI

NM_031407

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... HUWE1(10075) , HUWE1(10075)

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Michael J Friez et al.
BMJ open, 6(4), e009537-e009537 (2016-05-01)
X linked intellectual disability (XLID) syndromes account for a substantial number of males with ID. Much progress has been made in identifying the genetic cause in many of the syndromes described 20-40 years ago. Next generation sequencing (NGS) has contributed to
Matthias Bosshard et al.
Scientific reports, 7(1), 15050-15050 (2017-11-10)
Mutations in the HECT, UBA and WWE domain-containing 1 (HUWE1) E3 ubiquitin ligase cause neurodevelopmental disorder X-linked intellectual disability (XLID). HUWE1 regulates essential processes such as genome integrity maintenance. Alterations in the genome integrity and accumulation of mutations have been
Dong Yang et al.
Theranostics, 8(13), 3517-3529 (2018-07-22)
Lung cancer is the most frequent cancer type and the leading cause of tumor-associated deaths worldwide. TP53 is an important tumor suppressor gene and is frequently inactivated in lung cancer. E3 ligases targeting p53, such as MDM2, are involved in
A Rolfo et al.
Cell death & disease, 3, e305-e305 (2012-05-04)
The E3 ubiquitin ligase MULE (Mcl-1 Ubiquitin Ligases E3) targets myeloid cell leukemia factor 1 (Mcl-1) and tumor suppressor p53 for proteasomal degradation. Although Mcl-1 and p53 have been implicated in trophoblast cell death in preeclampsia (PE) and intrauterine growth
Lisa J Crawford et al.
Oncogene, 39(27), 5001-5014 (2020-06-12)
Proteasome inhibitors have provided a significant advance in the treatment of multiple myeloma (MM). Consequently, there is increasing interest in developing strategies to target E3 ligases, de-ubiquitinases, and/or ubiquitin receptors within the ubiquitin proteasome pathway, with an aim to achieve
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica