Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU067431

Sigma-Aldrich

MISSION® esiRNA

targeting human HP

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TTGGGCTCATCAAACTCAAACAGAAGGTGTCTGTTAATGAGAGAGTGATGCCCATCTGCCTACCTTCAAAGGATTATGCAGAAGTAGGGCGTGTGGGTTATGTTTCTGGCTGGGGGCGAAATGCCAATTTTAAATTTACTGACCATCTGAAGTATGTCATGCTGCCTGTGGCTGACCAAGACCAATGCATAAGGCATTATGAAGGCAGCACAGTCCCCGAAAAGAAGACACCGAAGAGCCCTGTAGGGGTGCAGCCCATACTGAATGAACACACCTTCTGTGCTGGCATGTCTAAGTACCAAGAAGACACCTGCTATGGCGATGCGGGCAGTGCCTTTGCCGTTCACGACCTGGAGGAGGACACCTGGTATGCGACTGGGATCTTAAGCTTTGATAAGAGCTGTGCTGTGGCTG

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Se precisar de ajuda, entre em contato Atendimento ao cliente

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Ho-Suk Mun et al.
Scientific reports, 5, 17697-17697 (2015-12-08)
Understanding the mechanisms of memory formation is fundamental to establishing optimal educational practices and restoring cognitive function in brain disease. Here, we show for the first time in a non-primate species, that spatial learning receives a special bonus from self-directed
Tomofumi Fujino et al.
The Journal of toxicological sciences, 40(4), 501-508 (2015-07-15)
Identification of substances with specific toxicity for carcinoma cells promises to facilitate the development of cancer chemotherapeutics that cause minimal side effects. Here, we show that knockdown of the farnesoid X receptor (FXR) effectively suppresses the proliferation of human hepatocellular

Global Trade Item Number

SKUGTIN
EHU067431-20UG4061828607754
EHU067431-50UG4061828384884

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica