Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU065141

Sigma-Aldrich

MISSION® esiRNA

targeting human SLC39A14

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CATGGACACAGCCATTATGCCTCTGAGTCGCTTCCCTCCAAGAAGGACCAGGAGGAGGGGGTGATGGAGAAGCTGCAGAACGGGGACCTGGACCACATGATTCCTCAGCACTGCAGCAGTGAGCTGGACGGCAAGGCGCCCATGGTGGACGAGAAGGTCATTGTGGGCTCGCTCTCTGTGCAGGACCTGCAGGCTTCCCAGAGTGCTTGCTACTGGCTGAAAGGTGTCCGCTACTCTGATATCGGCACTCTGGCCTGGATGATCACTCTGAGCGACGGCCTCCATAATTTCATCGATGGCCTGGCCATCGGTGCTTCCTTCACTGTGTCAGTTTTCCAAGGCATCAGCACCTCGGTGGCCATCCTCTGTGAGGAGTTCCCACATGAGCTAGGAGACTTTGTCATCCTGCTCAACG

Ensembl | Número de adesão de ser humano

ENSG00000104635

nº de adesão NCBI

NM_015359

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... SLC39A14(23516) , SLC39A14(23516)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Tolunay Beker Aydemir et al.
The Journal of biological chemistry, 291(46), 23939-23951 (2016-10-21)
Zinc influences signaling pathways through controlled targeted zinc transport. Zinc transporter Zip14 KO mice display a phenotype that includes impaired intestinal barrier function with low grade chronic inflammation, hyperinsulinemia, and increased body fat, which are signatures of diet-induced diabetes (type
Brittany L Steimle et al.
The Journal of biological chemistry, 294(50), 19197-19208 (2019-11-09)
Manganese supports numerous neuronal functions but in excess is neurotoxic. Consequently, regulation of manganese flux at the blood-brain barrier (BBB) is critical to brain homeostasis. However, the molecular pathways supporting the transcellular trafficking of divalent manganese ions within the microvascular
Yu Han et al.
Metallomics : integrated biometal science, 12(3), 346-362 (2020-01-18)
Zinc is the second most abundant transition metal in humans and an essential nutrient required for growth and development of newborns. During lactation, mammary epithelial cells differentiate into a secretory phenotype, uptake zinc from blood circulation, and export it into

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica