Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU064421

Sigma-Aldrich

MISSION® esiRNA

targeting human SESN3

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GATGGTCCCCTTCCTCTACCATACAGGCACTATATTGCAATAATGGCTGCAGCTAGACATCAGTGTTCTTACTTAATAAACATGCATGTGGATGAATTTTTAAAGACTGGAGGTATTGCTGAGTGGTTGAATGGTTTGGAATATGTGCCACAAAGACTGAAAAATCTTAATGAAATTAATAAGCTGCTAGCACATCGACCTTGGCTGATCACAAAAGAGCACATTCAGAAACTTGTCAAAACTGGAGAAAATAATTGGTCTCTGCCTGAACTGGTACATGCTGTGGTCCTCCTGGCACATTATCATGCTTTGGCAAGCTTTGTTTTTGGTAGTGGTATCAATCCAGAGAGAGATCCAGAAATCTCCAATGGATTCAGGCTAATATCAGTCAACAATTTCTGCGTTTGTGATCTTGC

Ensembl | Número de adesão de ser humano

ENSG00000149212

nº de adesão NCBI

NM_144665

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... SESN3(143686) , SESN3(143686)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Se precisar de ajuda, entre em contato Atendimento ao cliente

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Yasuo Miki et al.
Neuroscience letters, 684, 35-41 (2018-07-04)
Neurodegenerative disorders such as Parkinson's disease (PD) and dementia with Lewy bodies (DLB) are characterized by impairment of autophagy. Cellular survival is dependent on efficient clearance of phosphorylated α-synuclein, which accumulates as fibrils in the neuronal cytoplasm as Lewy bodies
Russell E Ericksen et al.
Cell metabolism, 29(5), 1151-1165 (2019-01-22)
Tumors display profound changes in cellular metabolism, yet how these changes aid the development and growth of tumors is not fully understood. Here we use a multi-omic approach to examine liver carcinogenesis and regeneration, and find that progressive loss of
Jianbin Zhang et al.
Autophagy, 11(4), 629-642 (2015-04-29)
Autophagy is a catabolic process in response to starvation or other stress conditions to sustain cellular homeostasis. At present, histone deacetylase inhibitors (HDACIs) are known to induce autophagy in cells through inhibition of mechanistic target of rapamycin (MTOR) pathway. FOXO1

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica