Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU064181

Sigma-Aldrich

MISSION® esiRNA

targeting human PKLR

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GTGAACCTCCAGAAGCCATCTGGGCAGATGATGTAGATCGCCGGGTGCAATTTGGCATTGAAAGTGGAAAGCTCCGTGGCTTCCTCCGTGTTGGAGACCTGGTGATTGTGGTGACAGGCTGGCGACCTGGCTCCGGCTACACCAACATCATGCGGGTGCTAAGCATATCCTGAGACGCCCCTCCCTCCTCTGGCCCAGCCTACCCTTGTACCCCATCCCTTCCTCCCCAGTCTACGTTCTCCAGCCCACACCCCTCCAAAGCCCCACCTTTAAGTCCTCTCTTCTCTATTCCTGACCCTCCCTACCTGAGGCCTATCTGAGACTATAACTGTCATCTAGCCCCTTCGAGGTTGCCCCTTCCCCATCTCCATTTCACACAGGTCCTGAAAGTCTGTGTCCAATTATGCACTGGCCAC

Ensembl | Número de adesão de ser humano

ENSG00000143627

nº de adesão NCBI

NM_000298

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... PKLR(5313) , PKLR(5313)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Xiaoqiong Duan et al.
Journal of virology, 92(7) (2018-01-13)
Hepatitis C virus (HCV) infection has been shown to regulate microRNA 130a (miR-130a) in patient biopsy specimens and in cultured cells. We sought to identify miR-130a target genes and to explore the mechanisms by which miR-130a regulates HCV and hepatitis
Stephanie Dabo et al.
Scientific reports, 7(1), 16129-16129 (2017-11-25)
PKR is a cellular kinase involved in the regulation of the integrative stress response (ISR) and pro-inflammatory pathways. Two N-terminal dsRNA Binding Domains (DRBD) are required for activation of PKR, by interaction with either dsRNA or PACT, another cellular DRBD-containing
D C Tanner et al.
Cell death and differentiation, 22(9), 1489-1501 (2015-01-31)
Neuroinflammation associated with degenerative central nervous system disease and injury frequently results in oligodendrocyte death. While promoting oligodendrocyte viability is a major therapeutic goal, little is known about protective signaling strategies. We report that in highly purified rat oligodendrocytes, interferon

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica