Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU063971

Sigma-Aldrich

MISSION® esiRNA

targeting human CALCR

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GGCCTGCAACTATTTCTGGATGCTCTGTGAAGGGATCTATCTTCATACACTCATTGTCGTGGCTGTGTTTACTGAGAAGCAACGCTTGCGGTGGTATTATCTCTTGGGCTGGGGGTTCCCGCTGGTGCCAACCACTATCCATGCTATTACCAGGGCCGTGTACTTCAATGACAACTGCTGGCTGAGTGTGGAAACCCATTTGCTTTACATAATCCATGGACCTGTCATGGCGGCACTTGTGGTCAATTTCTTCTTTTTGCTCAACATTGTCCGGGTGCTTGTGACCAAAATGAGGGAAACCCATGAGGCGGAATCCCACATGTACCTGAAGGCTGTGAAGGCCACCATGATCCTTGTGCCCCTGCTGGGAATCCAGTTTGTCGTCTTTCCCTGGAGACCTTCCAACAAGATGCTTGGGAAGATATATGATTACGTGATGCACTCTCTGATTCATTTCCAGGGCTTCTTTG

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Barbara Toffoli et al.
Clinical science (London, England : 1979), 134(17), 2337-2352 (2020-08-29)
TNF-related apoptosis-inducing ligand (TRAIL) has attracted attention not only as an anti-cancer agent, but also as a potential treatment for diabetes. Animal studies have shown that TRAIL delivery ameliorated glucose control in type 1 and type 2 diabetes. It is
Ruo Feng et al.
Diagnostic pathology, 10, 149-149 (2015-08-27)
Hepatocellular carcinoma (HCC) is one of the most frequent cancers in the world. Calreticulin(CRT) is aberrantly overexpressed in many human cancer cells. The function of CRT in HCC cells remains unclear. We attempted to investigate the effects and the underlying
Saurabh Vig et al.
Cell cycle (Georgetown, Tex.), 14(14), 2274-2284 (2015-05-07)
Calreticulin (CRT) is an endoplasmic reticulum (ER) resident calcium binding protein that is involved in several cellular activities. Transcriptome analyses in CRT knockdown HepG2 cells revealed 253 altered unique genes and subsequent in silico protein-protein interaction network and MCODE clustering
Beatrice Rondinelli et al.
Nucleic acids research, 43(5), 2560-2574 (2015-02-26)
DNA replication is a tightly regulated process that initiates from multiple replication origins and leads to the faithful transmission of the genetic material. For proper DNA replication, the chromatin surrounding origins needs to be remodeled. However, remarkably little is known
Xuemin Wang et al.
PloS one, 10(4), e0125402-e0125402 (2015-05-01)
Cisplatin is one of the first-line platinum-based chemotherapeutic agents for treatment of many types of cancer, including ovary cancer. CTR1 (copper transporter 1), a transmembrane solute carrier transporter, has previously been shown to increase the cellular uptake and sensitivity of

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica