Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU063531

Sigma-Aldrich

MISSION® esiRNA

targeting human ACO1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

ACTTTGAGAGCTGCCTTGGAGCCAAGCAAGGATTTAAAGGATTCCAAGTTGCTCCTGAACATCATAATGACCATAAGACCTTTATCTATGATAACACTGAATTCACCCTTGCTCATGGTTCTGTGGTCATTGCTGCCATTACTAGCTGCACAAACACCAGTAATCCGTCTGTGATGTTAGGGGCAGGATTGTTAGCAAAGAAAGCTGTGGATGCTGGCCTGAACGTGATGCCTTACATCAAAACTAGCCTGTCTCCTGGGAGTGGCGTGGTCACCTACTACCTACAAGAAAGCGGAGTCATGCCTTATCTGTCTCAGCTTGGGTTTGACGTGGTGGGCTATGGCTGCATGACCTGCATTGGCAACAGTGGGCCTTTACCTGAACCTGTGGTAGAAGCCATCACACAGGGAGACCTT

Ensembl | Número de adesão de ser humano

ENSG00000122729

nº de adesão NCBI

NM_002197

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... ACO1(48) , ACO1(48)

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Jin Zhang et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 34(2), 2301-2311 (2020-01-08)
Iron is an essential element to all living organisms and plays a vital role in many cellular processes, such as DNA synthesis and energy production. The Mdm2 oncogene is an E3 ligase and known to promote tumor growth. However, the
Filomena Fiorito et al.
PloS one, 8(3), e58845-e58845 (2013-03-23)
Mammalian cells require iron to satisfy metabolic needs or to accomplish specialized functions, and DNA viruses, like bovine herpesvirus 1 (BHV-1), require an iron-replete host to efficiently replicate, so that iron bioavailability is an important component of viral virulence. Cellular
Laura Gonzalez-Sanchez et al.
Carcinogenesis, 41(8), 1113-1122 (2019-11-18)
Precursor T-cell lymphoblastic neoplasms are aggressive malignancies in need for more effective and specific therapeutic treatments. A significant fraction of these neoplasms harbor deletions on the locus 9p21, targeting the tumor suppressor CDKN2A but also deleting the aconitase 1 (ACO1)

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica