Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU062411

Sigma-Aldrich

MISSION® esiRNA

targeting human TRAF2

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CTTGGAGCAGAAGGTCTTGGAGATGGAGGCATCCACCTACGATGGGGTCTTCATCTGGAAGATCTCAGACTTCGCCAGGAAGCGCCAGGAAGCTGTGGCTGGCCGCATACCCGCCATCTTCTCCCCAGCCTTCTACACCAGCAGGTACGGCTACAAGATGTGTCTGCGTATCTACCTGAACGGCGACGGCACCGGGCGAGGAACACACCTGTCCCTCTTCTTTGTGGTGATGAAGGGCCCGAATGACGCCCTGCTGCGGTGGCCCTTCAACCAGAAGGTGACCTTAATGCTGCTCGACCAGAATAACCGGGAGCACGTGATTGACGCCTTCAGGCCCGACGTGACTTCATCCTCTTTTCAGAGGCCAGTCAACGACATGAACATCGCAAGCGGCTGCCCCCTCTTCTGCCCCGTCTCCAAGATGGAGGCAAAGAATTCCTACGTGCGGGACGATGCCATCTTCATCAAGGCCATT

Ensembl | Número de adesão de ser humano

ENSG00000127191

nº de adesão NCBI

NM_021138

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... TRAF2(7186) , TRAF2(7186)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Hong Cheng et al.
The Journal of investigative dermatology, 135(10), 2427-2436 (2015-05-29)
Previously, tumor necrosis factor (TNF)-like weak inducer of apoptosis (TWEAK) had been known to be an inducer of apoptosis of keratinocytes by engaging the Fn14 receptor. However, the high-risk human papillomavirus (HPV) infection confers a proliferation advantage on keratinocytes that
I Karl et al.
Cell death & disease, 5, e1444-e1444 (2014-10-10)
The relevance of the adaptor protein TNF receptor-associated factor 2 (TRAF2) for signal transduction of the death receptor tumour necrosis factor receptor1 (TNFR1) is well-established. The role of TRAF2 for signalling by CD95 and the TNF-related apoptosis inducing ligand (TRAIL)
Alexey V Sorokin et al.
Cancer research, 75(9), 1846-1858 (2015-04-17)
The protein tyrosine phosphatase receptor PTPRN2 is expressed predominantly in endocrine and neuronal cells, where it functions in exocytosis. We found that its immature isoform proPTPRN2 is overexpressed in various cancers, including breast cancer. High proPTPRN2 expression was associated strongly

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica