Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU060941

Sigma-Aldrich

MISSION® esiRNA

targeting human MXI1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GCAGTGCAGTTGAGTTGTGTGTTAATGTTAGACTATCCCTTTGTGAGTGACACTTTAACAGCATTCACTGCTTCTATATATAGTGTACCATCTTGGTCATACATTACGCCTCAACATATACTTGTGCTCTTCCTTTGCCTCCAGAAGAAGTTTTTCCTTGATTGTGCTATGTTTCAGTGGAAGAAATTCTTTGAAGTAGATGTGAGTGAAAAACTGCATGCCTTTAGAAGCCCAGTATCAGAACTTGCTACGTTTCAGGTGCTAGGGACTTAATGAAAAACAGGACAAAACAATTCCTTTTTGTGGCCCAGGTAAATTATTTCTGGTTTCACTTATAATTACTAATGGCTGAGTCAAGATGTTGTCTCTGTGTTTGCTTACTCTTGATCAAGTGTGAGACAGTTTGAAGACTGTGCTACCATACAAAGTGAATGAAGCCAGTGACTAAGCTTCTGTTTGTTTTGTTATTCTCATGGCCTTCGCT

Ensembl | Número de adesão de ser humano

ENSG00000119950

nº de adesão NCBI

NM_001008541

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... MXI1(4601) , MXI1(4601)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Jianwen Zhou et al.
PloS one, 8(12), e83055-e83055 (2014-01-01)
Gliomas are the most common and aggressive primary tumors in the central nervous system. Recently, Max interactor-1 (MXI1), an antagonist of c-Myc that is involved in brain tumor progression, has been reported to be deregulated in a variety of tumors
Stacie E Dodgson et al.
Genes & development, 30(20), 2259-2271 (2016-11-04)
Aneuploidy-or an unbalanced karyotype in which whole chromosomes are gained or lost-causes reduced fitness at both the cellular and organismal levels but is also a hallmark of human cancers. Aneuploidy causes a variety of cellular stresses, including genomic instability, proteotoxic
Xingkang Wu et al.
Biochemical and biophysical research communications, 499(4), 927-933 (2018-04-08)
Colorectal cancer (CRC) is the third most prevalent malignancy worldwide. New understandings about this disease are urgently required to guide clinical therapies. In this study, we focused on the effects of the small molecule PMN on CRC cells. PMN dose-dependently
Ana Vanessa Nascimento et al.
Acta biomaterialia, 47, 71-80 (2016-10-19)
Efficiency of chemotherapy is often limited by low therapeutic index of the drug as well as emergence of inherent and acquired drug resistance in cancer cells. As a common strategy to overcome drug resistance, higher doses of chemo-agents are administered.

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica