Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU059281

Sigma-Aldrich

MISSION® esiRNA

targeting human TCF12

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CCATCCTGGGCTTAGTGAAACTACCAACCCTATGGGTCATATGTAAACATCAGCCAGTTCCAGAGTTATCAGTAGGCTAGATAGAAGGTGACCTCTCCTCATAAGGACTTGGACAACTCAGATTATCTGAAGACACAAACCTGACAGGAGGGAGAAGAAAAAACAAAACACTTGAACCAAGAAACTCAAATGTAATCCTACGATCAAAGCAACTGGTCAACACTTCCATCAGAAGTGAAGATAGGAAGCTCATCAGATAGAACATCAGCCCATGAGATGTTTGCAACAAATCTTTTGTTGCAAGCAGTGTGTCGCTTCTGCACAATCAGAGACTGTCTCGATCTCTCCACTCACCGTGGAAGTTGCCTTGTGCCTAAACTGAATTGACAAATGCATTGTAACTACAAATTTTATTTATTGTTATGAAACTGTAAGGTCTACATATAAAGGGAAAAAGTTAATGTGGAAAGCTGATCTACACTCAGCTGATGCCA

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Lamentamos, não temos COA para este produto disponíveis online no momento.

Se precisar de ajuda, entre em contato Atendimento ao cliente

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Paulo R D V Godoy et al.
Molecular medicine reports, 14(6), 5253-5260 (2016-10-26)
Glioblastoma multiforme (GBM) is a lethal tumor and novel strategies are required to overcome resistance. Transcription factor 12 (HEB) has been associated with neural and stem cell proliferation, is overexpressed in certain tumor types and is induced in irradiated U87MG cells.
Leila Pirhaji et al.
Nature communications, 8(1), 623-623 (2017-09-22)
The immense and growing repositories of transcriptional data may contain critical insights for developing new therapies. Current approaches to mining these data largely rely on binary classifications of disease vs. control, and are not able to incorporate measures of disease
Duo Wen et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 36(8), 6211-6221 (2015-03-11)
Malic enzyme 1 (ME1) links the glycolytic and citric acid cycles and is important for NADPH production, glutamine metabolism, and lipogenesis. Recently, its deregulation has been implicated in the progression of various cancers. However, the role of ME1 in the

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica