Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU058001

Sigma-Aldrich

MISSION® esiRNA

targeting human CLU

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GACTCTGCTGCTGTTTGTGGGGCTGCTGCTGACCTGGGAGAGTGGGCAGGTCCTGGGGGACCAGACGGTCTCAGACAATGAGCTCCAGGAAATGTCCAATCAGGGAAGTAAGTACGTCAATAAGGAAATTCAAAATGCTGTCAACGGGGTGAAACAGATAAAGACTCTCATAGAAAAAACAAACGAAGAGCGCAAGACACTGCTCAGCAACCTAGAAGAAGCCAAGAAGAAGAAAGAGGATGCCCTAAATGAGACCAGGGAATCAGAGACAAAGCTGAAGGAGCTCCCAGGAGTGTGCAATGAGACCATGATGGCCCTCTGGGAAGAGTGTAAGCCCTGCCTGAAACAGACCTGCATGAAGTTCTACGCACGCGTCTGCAGAAGTGGCTCAGGCCTGGTTGGCCGCCAGCTTGAGGAGTTCCTGAACCAGAGCTCGCCCTTCTAC

Ensembl | Número de adesão de ser humano

ENSG00000120885

nº de adesão NCBI

NM_001831

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... CLU(1191) , CLU(1191)

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Na Fu et al.
Life sciences, 256, 117911-117911 (2020-06-07)
To explore the potential regulatory mechanism of differentially expressed mRNAs in Hepatitis C virus (HCV)-related hepatocellular carcinoma (HCC). Patients with HCV-related HCC and age- and gender-matched healthy subjects were enrolled. Differentially expressed mRNAs in the plasma were detected by digital
Alice Filippini et al.
Glia, 69(3), 681-696 (2020-10-13)
The progressive neuropathological damage seen in Parkinson's disease (PD) is thought to be related to the spreading of aggregated forms of α-synuclein. Clearance of extracellular α-synuclein released by degenerating neurons may be therefore a key mechanism to control the concentration
Jung-Yoon Heo et al.
The Journal of endocrinology, 237(2), 175-191 (2018-03-23)
Clusterin is a secretory glycoprotein that is involved in multiple physiopathological processes, including lipid metabolism. Previous studies have shown that clusterin prevents hepatic lipid accumulation via suppression of sterol regulatory element-binding protein (SREBP) 1. In this study, we examined the
Patricia M Schnepp et al.
Cancer research, 77(11), 2844-2856 (2017-04-13)
The impact of altered amino acid metabolism on cancer progression is not fully understood. We hypothesized that a metabolic transcriptome shift during metastatic evolution is crucial for brain metastasis. Here, we report a powerful impact in this setting caused by

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica