Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU056781

Sigma-Aldrich

MISSION® esiRNA

targeting human ADAMTS3

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

TGAACCATGTTTGGGAGACAAGTCCATATTCTGTCAAATGGAAGTGTTGGCACGATACTGCTCCATACCAGGTTATAACAAGTTATGTTGTGAGTCCTGCAGCAAGCGCAGTAGCACCCTGCCACCACCATACCTTCTAGAAGCTGCTGAAACTCATGATGATGTCATCTCTAACCCTAGTGACCTCCCTAGATCTCTAGTGATGCCTACATCTTTGGTTCCTTATCATTCAGAGACCCCTGCAAAGAAGATGTCTTTGAGTAGCATCTCTTCAGTGGGAGGTCCAAATGCATATGCTGCTTTCAGGCCAAACAGTAAACCTGATGGTGCTAATTTACGCCAGAGGAGTGCTCAGCAAGCAGGAAGTAAGACTGTGAGACTGGTCACCGTACCATCCTCCCCACCCACCAAGAGGGTCCACCTCAGTTCAGCTTCACAAATGGCTG

Ensembl | Número de adesão de ser humano

ENSG00000156140

nº de adesão NCBI

NM_014243

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... ADAMTS3(9508) , ADAMTS3(9508)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Pingping Ren et al.
Scientific reports, 7(1), 12351-12351 (2017-09-29)
Sporadic aortic aneurysm and dissections (AADs) are common vascular diseases that carry a high mortality rate. ADAMTS-4 (a disintegrin-like and metalloproteinase with thrombospondin motifs-4) is a secreted proteinase involved in inflammation and matrix degradation. We previously showed ADAMTS-4 levels were
Zheng Li et al.
PloS one, 9(10), e109595-e109595 (2014-10-10)
The mechanistic basis of obesity-associated intervertebral disc degeneration (IDD) is unclear. Aberrant expression of aggrecan and its degrading enzymes ADAMTS-4 and ADAMTS-5 is implicated in the development of IDD. Here, we investigated the effect of leptin, a hormone with increased

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica