Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU056071

Sigma-Aldrich

MISSION® esiRNA

targeting human ITPR2

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CAACCCTCCCAAGAAGTTCAGAGACTGCCTTTTCAAGGTGTGCCCTATGAACAGATATTCTGCCCAGAAGCAATATTGGAAAGCAAAGCAAGCCAAACAAGGGAACCACACCGAGGCAGCCTTGCTGAAGAAACTACAGCACGCTGCAGAACTGGAACAAAAACAAAATGAATCGGAGAATAAGAAACTGTTGGGAGAAATTGTAAAATACAGTAATGTTATACAACTACTGCATATAAAAAGCAACAAATATCTTACTGTCAACAAGAGATTACCTGCTTTACTGGAGAAGAATGCCATGCGTGTGTCCTTGGATGCTGCAGGAAATGAAGGGTCTTGGTTTTATATTCATCCGTTCTGGAAACTGAGAAGCGAGGGTGA

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Lamentamos, não temos COA para este produto disponíveis online no momento.

Se precisar de ajuda, entre em contato Atendimento ao cliente

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Raul Lagos-Cabré et al.
Cell reports, 33(11), 108483-108483 (2020-12-17)
The mitotic spindle distributes chromosomes evenly to daughter cells during mitosis. The orientation of the spindle, guided by internal and external cues, determines the axis of cell division and thereby contributes to tissue morphogenesis. Progression through mitosis requires local Ca2+
Takashi Nozawa et al.
Nature communications, 11(1), 770-770 (2020-02-09)
Invading microbial pathogens can be eliminated selectively by xenophagy. Ubiquitin-mediated autophagy receptors are phosphorylated by TANK-binding kinase 1 (TBK1) and recruited to ubiquitinated bacteria to facilitate autophagosome formation during xenophagy, but the molecular mechanism underlying TBK1 activation in response to

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica