Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU054411

Sigma-Aldrich

MISSION® esiRNA

targeting human USF1

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CCTGGCACTGGTCAATTCTTTGTGATGATGTCACCACAAGAAGTACTGCAGGGAGGAAGCCAGCGCTCAATTGCCCCTAGGACTCACCCTTATTCCCCGAAGTCAGAAGCTCCCCGGACGACTCGGGATGAGAAACGCAGGGCTCAGCATAATGAAGTGGAGCGTCGCCGCCGAGACAAGATCAACAACTGGATCGTGCAGCTCTCCAAGATAATCCCAGACTGCTCTATGGAGAGCACCAAGTCTGGCCAGAGTAAAGGTGGGATTCTATCCAAAGCTTGTGATTATATCCAGGAGCTTCGGCAGAGTAACCACCGCTTGTCTGAAGAACTGCAGGGACTTGACCAACTGCAGCTGGACAATGACGTGCTTCGACAACAGGTGGAAGATCTTAAAAACAAGAATCTGCTGCTTCGAGCTCAGTTGCGGCACCACGGATTAGAGGTCGT

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Se precisar de ajuda, entre em contato Atendimento ao cliente

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Xiangxiang Liu et al.
Molecular therapy. Nucleic acids, 22, 750-765 (2020-11-25)
Hepatocellular carcinoma (HCC), one of the most aggressive malignancies, ranks as the fourth leading cause of cancer-related deaths worldwide. Emerging evidence indicates that RNA N6-methyladenosine (m6A) plays a critical role in tumor progression. However, the biological function of YTHDF1 in
Xiu-Juan Ding et al.
Theranostics, 10(24), 11110-11126 (2020-10-13)
Rationale: Many external factors can induce the melanogenesis and inflammation of the skin. Salidroside (SAL) is the main active ingredient of Rhodiola, which is a perennial grass plant of the Family Crassulaceae. This study evaluated the effect and molecular mechanism
Jun Guo et al.
FEBS letters, 592(16), 2725-2738 (2018-07-29)
Previous studies indicate that the transcription factor upstream stimulating factor 1 (USF1) is involved in the regulation of lipid and glucose metabolism. However, the role of USF1 in lipid-induced autophagy remains unknown. Interestingly, we found that USF1 overexpression suppresses autophagy-related
Chunyu Cao et al.
International journal of cancer, 143(6), 1388-1401 (2018-04-11)
Our recent studies have shown that cross-talk between histone deacetylase 5 (HDAC5) and lysine-specific demethylase 1 (LSD1) facilitates breast cancer progression. In this work, we demonstrated that regulatory activity at -356 to -100 bp promoter element plays a critical role
Griselda Vallejo et al.
PloS one, 9(5), e97311-e97311 (2014-05-27)
Although non-genomic steroid receptor pathways have been studied over the past decade, little is known about the direct gene expression changes that take place as a consequence of their activation. Progesterone controls proliferation of rat endometrial stromal cells during the

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica