Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU051021

Sigma-Aldrich

MISSION® esiRNA

targeting human UCP1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

TCTCCACGGAATCAAACCTCGCTACACGGGGACTTATAATGCGTACAGAATAATAGCAACAACCGAAGGCTTGACGGGTCTTTGGAAAGGGACTACTCCCAATCTGATGAGAAGTGTCATCATCAATTGTACAGAGCTAGTAACATATGATCTAATGAAGGAGGCCTTTGTGAAAAACAACATATTAGCAGATGACGTCCCCTGCCACTTGGTGTCGGCTCTTATCGCTGGATTTTGCGCAACAGCTATGTCCTCCCCGGTGGATGTAGTAAAAACCAGATTTATTAATTCTCCACCAGGACAGTACAAAAGTGTGCCCAACTGTGCAATGAAAGTGTTCACTAACGAAGGACCAACGGCTTTCTTCAAGGGGTTGGTACCTTCCTTCTTGCGACTTGGAT

Ensembl | Número de adesão de ser humano

ENSG00000109424

nº de adesão NCBI

NM_021833

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... UCP1(7350) , UCP1(7350)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Jung Hwa Lim et al.
PloS one, 11(9), e0163710-e0163710 (2016-09-30)
Here, we show that E2-EPF ubiquitin carrier protein (UCP) elongated E3-independent polyubiquitin chains on the lysine residues of von Hippel-Lindau protein (pVHL) and its own lysine residues both in vitro and in vivo. The initiation of the ubiquitin reaction depended
Zhiyong Xiong et al.
Advanced science (Weinheim, Baden-Wurttemberg, Germany), 6(10), 1801862-1801862 (2019-05-28)
Emerging evidence has highlighted the important role of abnormal lipid accumulation in cancer development and progression, but the mechanism for this phenomenon remains unclear. Here, it is demonstrated that phospholipase C-like 1/uncoupling protein 1 (PLCL1)/(UCP1)-mediated lipid browning promotes tumor cell
Jae Hoon Jeong et al.
Scientific reports, 8(1), 6672-6672 (2018-04-29)
Release of fatty acids from lipid droplets upon activation of the sympathetic nervous system (SNS) is a key step in nonshivering thermogenesis in brown adipose tissue (BAT). However, intracellular lipolysis appears not to be critical for cold-induced thermogenesis. As activation

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica