Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU050541

Sigma-Aldrich

MISSION® esiRNA

targeting human FSCN1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

ACCTGTCTGCCAATCAGGACGAGGAGACCGACCAGGAGACCTTCCAGCTGGAGATCGACCGCGACACCAAAAAGTGTGCCTTCCGTACCCACACGGGCAAGTACTGGACGCTGACGGCCACCGGGGGCGTGCAGTCCACCGCCTCCAGCAAGAATGCCAGCTGCTACTTTGACATCGAGTGGCGTGACCGGCGCATCACACTGAGGGCGTCCAATGGCAAGTTTGTGACCTCCAAGAAGAATGGGCAGCTGGCCGCCTCGGTGGAGACAGCAGGGGACTCAGAGCTCTTCCTCATGAAGCTCATCAACCGCCCCATCATCGTGTTCCGCGGGGAGCATGGCTTCATCGGCTGCCGCAAGGTCACGGGCACCCTGGACGCCAACCGCTCCAGCTATGACGTCTTCCAGCTGGAGTTCAACGATGGCGCCTACAACATCAAAGACTCCACAGGCA

Ensembl | Número de adesão de ser humano

ENSG00000075618

nº de adesão NCBI

NM_003088

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... FSCN1(6624) , FSCN1(6624)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Wei Gao et al.
Molecular therapy : the journal of the American Society of Gene Therapy, 27(2), 365-379 (2018-10-21)
Laryngeal squamous cell carcinoma (LSCC) is a common form of head and neck cancer with poor prognosis. However, the mechanism underlying the pathogenesis of LSCC remains unclear. Here, we demonstrated increased expression of fascin actin-bundling protein 1 (FSCN1) and decreased
Priscila Campioni Rodrigues et al.
Oncotarget, 8(43), 74736-74754 (2017-11-02)
Oral squamous cell carcinoma (OSCC) prognosis is related to clinical stage and histological grade. However, this stratification needs to be refined. We conducted a comparative proteome study in microdissected samples from normal oral mucosa and OSCC to identify biomarkers for
Aihua Luo et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 73, 75-79 (2015-07-28)
Fascin actin-bundling protein 1 (FSCN1) plays significant roles in biological processes such as tumor cell invasion and metastasis. However, little is known about prognostic value of FSCN1 in non-small cell lung cancer (NSCLC). FSCN1 mRNA and protein expression were detected
Sean McGuire et al.
Gynecologic oncology, 153(2), 405-415 (2019-02-25)
Ovarian cancer (OvCa) metastasis requires the coordinated motility of both cancer and stromal cells. Cellular movement is a dynamic process that involves the synchronized assembly of f-actin bundles into cytoskeletal protrusions by fascin. Fascin directly binds f-actin and is an
Jia-jia Chen et al.
PloS one, 10(5), e0126890-e0126890 (2015-05-27)
MicroRNAs (miRs) play important roles in modulating gene expression during the processes of tumorigenesis and tumor development. Previous studies have found that miR-145 is down-regulated in the stomach neoplasm and is related to tumor migration and invasion. However, both the
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica