Pular para o conteúdo
Merck
Todas as fotos(2)

Documentos Principais

EHU048671

Sigma-Aldrich

MISSION® esiRNA

targeting human CAT

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

ACATGGTCTGGGACTTCTGGAGCCTACGTCCTGAGTCTCTGCATCAGGTTTCTTTCTTGTTCAGTGATCGGGGGATTCCAGATGGACATCGCCACATGAATGGATATGGATCACATACTTTCAAGCTGGTTAATGCAAATGGGGAGGCAGTTTATTGCAAATTCCATTATAAGACTGACCAGGGCATCAAAAACCTTTCTGTTGAAGATGCGGCGAGACTTTCCCAGGAAGATCCTGACTATGGCATCCGGGATCTTTTTAACGCCATTGCCACAGGAAAGTACCCCTCCTGGACTTTTTACATCCAGGTCATGACATTTAATCAGGCAGAAACTTTTCCATTTAATCCATTCGATCTCACCAAGGTTTGGCCTCACAAGGACTACCCTCTCATCCCAGTTGG

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... CAT(847) , CAT(847)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Mikko Konki et al.
Scientific reports, 6, 22190-22190 (2016-02-26)
Epigenomic regulation is likely to be important in the maintenance of genomic integrity of human pluripotent stem cells, however, the mechanisms are unknown. We explored the epigenomes and transcriptomes of human pluripotent stem cells before and after spontaneous transformation to
Lilibeth Lanceta et al.
PloS one, 10(8), e0134144-e0134144 (2015-08-14)
Earlier observations indicate that free heme is selectively toxic to cells lacking heme oxygenase-1 (HO-1) but how this enzyme prevents heme toxicity remains unexplained. Here, using A549 (human lung cancer) and immortalized human bronchial epithelial cells incubated with exogenous heme

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica