Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU048191

Sigma-Aldrich

MISSION® esiRNA

targeting human SNAI2

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

TCGGACCCACACATTACCTTGTGTTTGCAAGATCTGCGGCAAGGCGTTTTCCAGACCCTGGTTGCTTCAAGGACACATTAGAACTCACACGGGGGAGAAGCCTTTTTCTTGCCCTCACTGCAACAGAGCATTTGCAGACAGGTCAAATCTGAGGGCTCATCTGCAGACCCATTCTGATGTAAAGAAATACCAGTGCAAAAACTGCTCCAAAACCTTCTCCAGAATGTCTCTCCTGCACAAACATGAGGAATCTGGCTGCTGTGTAGCACACTGAGTGACGCAATCAATGTTTACTCGAACAGAATGCATTTCTTCACTCCGAAGCCAAATGACAAATAAAGTCCAAAGGCATTTTCTCCTGTGCTGACCAACCAAATAATATGTATAGACACACACACATATGCACACACACACACACACACCCACAGAGAGAGAGCTGCAAGAGCATGGAATTCA

Ensembl | Número de adesão de ser humano

ENSG00000019549

nº de adesão NCBI

NM_003068

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... SNAI2(6591) , SNAI2(6591)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Carla L Alves et al.
Breast cancer research : BCR, 20(1), 60-60 (2018-06-21)
Endocrine resistance in estrogen receptor-positive (ER+) breast cancer is a major clinical problem and is associated with accelerated cancer cell growth, increased motility and acquisition of mesenchymal characteristics. However, the specific molecules and pathways involved in these altered features remain
Di-Di Chen et al.
American journal of physiology. Gastrointestinal and liver physiology, 317(2), G147-G160 (2019-04-04)
Invasion and metastasis are responsible for the majority of deaths in gastric cancer (GC). microRNA-33a (miR-33a) might function as a tumor suppressor in multiple cancers. Here, we describe the regulation and function of miR-33a in GC and mechanisms involved in
Dong Hyun Jo et al.
Oncotarget, 8(9), 15441-15452 (2017-01-07)
Retinoblastoma is the most common intraocular cancer in children, affecting 1/20,000 live births. Currently, children with retinoblastoma were treated with chemotherapy using drugs such as carboplatin, vincristine, and etoposide. Unfortunately, if conventional treatment fails, the affected eyes should be removed
Mijung Kwon et al.
Oncotarget, 7(47), 77052-77070 (2016-10-25)
Filamin A interacting protein 1-like (FILIP1L) is an inhibitor of the canonical WNT pathway. WNT/β-catenin signaling and its downstream pathway, epithelial-to-mesenchymal transition (EMT), play a key role in ovarian cancer metastasis and chemoresistance. To study the clinical implications of FILIP1L
Ziliang Wang et al.
Oncotarget, 6(9), 6670-6683 (2015-03-10)
While Aurora-A (Aur A) provokes, BRCA2 restrains primary tumorigenesis, the roles of Aur A and BRCA2 in cancer metastasis remains unclear. Here, we show that the metastatic promoting markers SLUG, FBN1, and MMP2, 9, 13 are either stimulated or suppressed
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica