Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU047911

Sigma-Aldrich

MISSION® esiRNA

targeting human ABCB10

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

TTTGACAAGACTCGCACAGGAGAATTGATTAACCGCCTCTCATCAGACACTGCACTCCTGGGGCGCTCAGTGACTGAAAACCTCTCAGATGGGCTCAGGGCCGGGGCCCAGGCTTCCGTAGGCATCAGTATGATGTTTTTTGTCTCACCTAATCTGGCCACCTTTGTTTTGAGCGTGGTGCCTCCAGTGTCAATCATTGCTGTAATTTATGGGCGATATCTACGGAAACTGACCAAAGTCACTCAGGATTCCCTGGCACAAGCCACTCAGCTAGCTGAGGAACGTATTGGAAATGTAAGAACTGTTCGAGCTTTTGGGAAAGAAATGACTGAAATCGAGAAATATGCCAGCAAAGTGGACCATGTAATGCAGTTAGCAAGGAAAGAGGCATTCGCCCGGGCTGGTTTCTTTGGAGCAACTGGGCTCTCCGGAAACCTGATCGTGCTTTCTGTCCTG

Ensembl | Número de adesão de ser humano

ENSG00000135776

nº de adesão NCBI

NM_012089

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... ABCB10(23456) , ABCB10(23456)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

W-Q Zhang et al.
European review for medical and pharmacological sciences, 24(11), 6088-6096 (2020-06-24)
Circ-ABCB10 is a non-coding RNA newly discovered in recent years. It has been observed to serve as an oncogene in a variety of tumors, but its biological function in esophageal squamous cell carcinoma (ESCC) is still unknown. The purpose of
Xuefang Lin et al.
Molecular medicine reports, 23(5) (2021-03-25)
Circular RNA ABCB10 (circ‑ABCB10) modulates cellular functions and microRNA (miR)‑1271 in epithelial ovarian cancer (EOC). The present study aimed to investigate the interaction between circ‑ABCB10 and miR‑1271 in regulating EOC cellular function and the calpain small subunit 1 (Capn4)/Wnt/β‑catenin signaling pathway.
Yan Chen et al.
Cancer biomarkers : section A of Disease markers, 26(2), 151-161 (2019-08-06)
This study aimed to explore the correlation of circular RNA ABCB10 (circ-ABCB10) expression with clinicopathological features and survival, as well as its impact on regulating cell proliferation and apoptosis in epithelial ovarian cancer (EOC). A total of 103 EOC patients

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica