Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU046081

Sigma-Aldrich

MISSION® esiRNA

targeting human FAT1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

AATTGCTGACAACGCCTCTCCGAAGTTTACATCAAAAGAATATTCTGTTGAACTTAGTGAAACTGTCAGCATTGGGAGTTTCGTTGGGATGGTTACAGCCCATAGTCAATCATCAGTGGTGTATGAAATAAAAGATGGAAATACAGGTGATGCTTTTGATATTAATCCACATTCTGGAACTATCATCACTCAGAAAGCCCTGGACTTTGAAACTTTGCCCATTTACACATTGATAATACAAGGAACTAACATGGCTGGTTTGTCCACTAATACAACGGTTCTAGTTCACTTGCAGGATGAGAATGACAACGCGCCAGTTTTTATGCAGGCAGAATATACAGGACTCATTAGTGAATCAGCCTCAATTAACAGCGTGGTCCTAACAGACAGGAATGTCCCACTGG

Ensembl | Número de adesão de ser humano

ENSG00000083857

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... FAT1(2195) , FAT1(2195)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Xinhui Wu et al.
Cell biology international, 41(1), 24-32 (2016-10-21)
Porcine cumulus cells are localized around oocytes and act as a specific type of granulosa that plays essential roles in the development and maturation of oocytes, the development and atresia of follicles, and the development of embryos. Studies of FAT1
Evanka Madan et al.
International journal of cancer, 139(11), 2570-2582 (2016-08-19)
The hypoxic microenvironment is an important contributor of glioblastoma (GBM) aggressiveness via HIF1α, while tumour inflammation is profoundly influenced by FAT Atypical Cadherin (FAT1). This study was designed to explore the functional interaction and significance of FAT1 and HIF1α under
Andrey Sheyko et al.
Nature, 539(7630), 551-554 (2016-11-08)
A striking feature of many natural dynamos is their ability to undergo polarity reversals. The best documented example is Earth's magnetic field, which has reversed hundreds of times during its history. The origin of geomagnetic polarity reversals lies in a
Tung-Nien Hsu et al.
Cancers, 11(12) (2019-12-01)
FAT atypical cadherin 1 (FAT1) regulates cell-cell adhesion and extracellular matrix architecture, while acting as tumor suppressor or oncogene, context-dependently. Despite implication of FAT1 in several malignancies, its role in oral squamous cell carcinoma (OSCC) remains unclear. Herein, we document
Longyue L Cao et al.
Nature, 539(7630), 575-578 (2016-11-10)
Mitochondrial products such as ATP, reactive oxygen species, and aspartate are key regulators of cellular metabolism and growth. Abnormal mitochondrial function compromises integrated growth-related processes such as development and tissue repair, as well as homeostatic mechanisms that counteract ageing and

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica