Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU043791

Sigma-Aldrich

MISSION® esiRNA

targeting human NUAK2

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CAAGATCGTGATCGTCATGGAGTATGCCAGCCGGGGCGACCTTTATGACTACATCAGCGAGCGGCAGCAGCTCAGTGAGCGCGAAGCTAGGCATTTCTTCCGGCAGATCGTCTCTGCCGTGCACTATTGCCATCAGAACAGAGTTGTCCACCGAGATCTCAAGCTGGAGAACATCCTCTTGGATGCCAATGGGAATATCAAGATTGCTGACTTCGGTCTCTCCAACCTCTACCATCAAGGCAAGTTCCTGCAGACATTCTGTGGGAGCCCCCTCTATGCCTCGCCAGAGATTGTCAATGGGAAGCCCTACACAGGCCCAGAGGTGGACAGCTGGTCCCTGGGTGTTCTCCTCTACATCCTGGTGCATGGCACCATGCCCTTTGATGGGCATGACCATAAGATCCTAGTGAAACAGATCAGCAACGGGGCCTACCGGGAGCCACCTAAACCCTCTGATGCCTG

Ensembl | Número de adesão de ser humano

ENSG00000163545

nº de adesão NCBI

NM_030952

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... NUAK2(81788) , NUAK2(81788)

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Devon E Mason et al.
The Journal of cell biology, 218(4), 1369-1389 (2019-02-10)
Cell migration initiates by traction generation through reciprocal actomyosin tension and focal adhesion reinforcement, but continued motility requires adaptive cytoskeletal remodeling and adhesion release. Here, we asked whether de novo gene expression contributes to this cytoskeletal feedback. We found that
Takeshi Namiki et al.
Cancer research, 75(13), 2708-2715 (2015-04-03)
The AMPK-related kinase NUAK2 has been implicated in melanoma growth and survival outcomes, but its therapeutic utility has yet to be confirmed. In this study, we show how its genetic amplification in PTEN-deficient melanomas may rationalize the use of CDK2
Mandeep K Gill et al.
Nature communications, 9(1), 3510-3510 (2018-08-31)
In most solid tumors, the Hippo pathway is inactivated through poorly understood mechanisms that result in the activation of the transcriptional regulators, YAP and TAZ. Here, we identify NUAK2 as a YAP/TAZ activator that directly inhibits LATS-mediated phosphorylation of YAP/TAZ

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica