Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU043401

Sigma-Aldrich

MISSION® esiRNA

targeting human LRP2

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TGTGGATGTGGATGTGTCCTCTGGCTTTATTTATTGGTGTGATTTTAGCAGCTCAGTGGCATCTGATAATGCGATCCGTAGAATTAAACCAGATGGATCTTCTCTGATGAACATTGTGACACATGGAATAGGAGAAAATGGAGTCCGGGGTATTGCAGTGGATTGGGTAGCAGGAAATCTTTATTTCACCAATGCCTTTGTTTCTGAAACACTGATAGAAGTTCTGCGGATCAATACTACTTACCGCCGTGTTCTTCTTAAAGTCACAGTGGACATGCCTAGGCATATTGTTGTAGATCCCAAGAACAGATACCTCTTCTGGGCTGACTATGGGCAGAGACCAAAGATTGAGCGTTCTTTCCTTGACTGTACCAATCGAACAGTGCTTGTGTCAGAGGGCATTGTC

Ensembl | Número de adesão de ser humano

ENSG00000081479

nº de adesão NCBI

NM_004525

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... LRP2(4036) , LRP2(4036)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
ITU
OLU
BCS
AXR

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Yuan Gao et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(6), 7684-7693 (2019-03-21)
Osteoblast differentiation of human mesenchymal stem cells (hMSCs) is stimulated by 1α,25-dihydroxycholecalciferol [1α,25(OH)2D3] and 25-hydroxycholecalciferol [25(OH)D3]; the latter's effects require intracellular hydroxylation to 1α,25(OH)2D3. Thus, hMSCs are both a source of and target for 1α,25(OH)2D3. Megalin is a transmembrane receptor
Rohit Upadhyay et al.
JCI insight, 5(14) (2020-06-17)
Free light chains (FLCs) induce inflammatory pathways in proximal tubule cells (PTCs). The role of TLRs in these responses is unknown. Here we present findings on the role of TLRs in FLC-induced PTC injury. We exposed human kidney PTC cultures
Aurélien Briens et al.
Cell discovery, 3, 17001-17001 (2017-04-19)
Plasminogen activation is involved in many processes within the central nervous system, including synaptic plasticity, neuroinflammation and neurodegeneration. However, the mechanisms that regulate plasminogen activation in the brain still remain unknown. Here we demonstrate that astrocytes participate in this regulation

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica