Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU043151

Sigma-Aldrich

MISSION® esiRNA

targeting human KPNB1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CTGCATGGACTGTAGGCAGAATTTGTGAGCTGCTTCCTGAAGCTGCCATCAATGATGTCTACTTGGCTCCCCTGCTACAGTGTCTGATTGAGGGTCTCAGTGCTGAACCCAGAGTGGCTTCAAATGTGTGCTGGGCTTTCTCCAGTCTGGCTGAAGCTGCTTATGAAGCTGCAGACGTTGCTGATGATCAGGAAGAACCAGCTACTTACTGCTTATCTTCTTCATTTGAACTCATAGTTCAGAAGCTCCTAGAGACTACAGACAGACCTGATGGACACCAGAACAACCTGAGGAGTTCTGCATATGAATCTCTGATGGAAATTGTGAAAAACAGTGCCAAGGATTGTTATCCTGCTGTCCAGAAAACGACTTTGGTCATCATGGAACGACTGCAACAGGTTCTTCA

Ensembl | Número de adesão de ser humano

ENSG00000108424

nº de adesão NCBI

NM_002265

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... KPNB1(3837) , KPNB1(3837)

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Noboru Sekimoto et al.
Journal of Cancer, 8(19), 4125-4140 (2017-12-01)
Lung cancer is a major cause of death worldwide, with lung adenocarcinoma being the most frequently diagnosed subtype in Japan. Finding the target of an anticancer drug can improve lung adenocarcinoma treatments. Polo-like kinase 1 (PLK1) is an essential mitotic
Michiko Kodama et al.
Proceedings of the National Academy of Sciences of the United States of America, 114(35), E7301-E7310 (2017-08-16)
Epithelial ovarian cancer (EOC) is a deadly cancer, and its prognosis has not been changed significantly during several decades. To seek new therapeutic targets for EOC, we performed an in vivo dropout screen in human tumor xenografts using a pooled
Zhen Wang et al.
Emerging microbes & infections, 9(1), 2030-2045 (2020-09-03)
The interferon-inducible myxovirus resistance B (MxB) protein has been reported to inhibit HIV-1 and herpesviruses by blocking the nuclear import of viral DNA. Here, we report a new antiviral mechanism in which MxB restricts the nuclear import of HIV-1 regulatory
Aihua Dai et al.
Neurochemical research, 40(11), 2177-2187 (2015-08-26)
Kpnb1, also known as Importin β1, is a member of the Karyopherin protein family which plays a important role in nuclear import and export pathways. Its expression has been shown to be responsive to stress, such as heat shock, ethanol

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica