Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU042681

Sigma-Aldrich

MISSION® esiRNA

targeting human IREB2

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

ATGCTTGCTGCAGGTCTTTTGGCTAAAAAGGCTGTTGAAGCTGGTCTGCGTGTTAAACCTTATATAAGAACAAGTTTATCTCCAGGCAGTGGGATGGTTACACATTACCTCAGTTCAAGTGGAGTATTACCATATCTAAGTAAGCTTGGATTTGAAATCGTTGGCTATGGATGTTCAATTTGTGTGGGAAATACAGCACCCTTATCAGACGCAGTTTTAAATGCAGTAAAACAGGGTGATTTGGTTACCTGTGGAATTTTATCTGGAAACAAAAATTTTGAAGGTCGTCTTTGTGATTGTGTTCGTGCCAATTATCTTGCCTCTCCACCCTTAGTGGTAGCTTATGCCATAGCAGGCACAGTGAATATAGATTTCCAGACAGAACCTTTAGGTACTGACCCCACCG

Ensembl | Número de adesão de ser humano

ENSG00000136381

nº de adesão NCBI

NM_004136

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... IREB2(3658) , IREB2(3658)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
QCS

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Fei Liu et al.
Cancer management and research, 11, 10891-10900 (2020-01-11)
Clear cell renal cell carcinoma (ccRCC) has the highest rate of metastasis and invasion in RCC and is the third most common adult urinary malignancy. miRNA may serve a critical role in human cancer development and progression, has been confirmed
Jin Zhang et al.
The Journal of pathology, 251(3), 284-296 (2020-04-19)
Ferredoxin reductase (FDXR) is a mitochondrial flavoprotein that initiates electron transport from NADPH to several cytochromes P450 via two electron carriers, ferredoxin 1 (FDX1) and FDX2. FDXR is the sole ferredoxin reductase in humans and plays a critical role in
Jin Zhang et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 34(2), 2301-2311 (2020-01-08)
Iron is an essential element to all living organisms and plays a vital role in many cellular processes, such as DNA synthesis and energy production. The Mdm2 oncogene is an E3 ligase and known to promote tumor growth. However, the
Toshifumi Hoki et al.
Hepatology (Baltimore, Md.), 62(3), 751-761 (2015-03-11)
Increased hepatic iron accumulation is thought to be involved in the pathogenesis of nonalcoholic steatohepatitis (NASH). Hepatic iron accumulation, as well as oxidative DNA damage, is significantly increased in NASH livers. However, the precise mechanism of iron accumulation in the
Filomena Fiorito et al.
PloS one, 8(3), e58845-e58845 (2013-03-23)
Mammalian cells require iron to satisfy metabolic needs or to accomplish specialized functions, and DNA viruses, like bovine herpesvirus 1 (BHV-1), require an iron-replete host to efficiently replicate, so that iron bioavailability is an important component of viral virulence. Cellular

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica