Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU042421

Sigma-Aldrich

MISSION® esiRNA

targeting human PIK3C3

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

TCAGCCAAGCATTGTTGAAGGGTGATAAGTCTGTCAGAGTTATGCGTTCTTTGCTGGCTGCACAACAGACATTTGTAGATCGGTTGGTGCATCTAATGAAGGCAGTACAACGCGAAAGTGGAAATCGTAAGAAAAAGAATGAGAGACTACAGGCATTGCTTGGAGATAATGAAAAGATGAATTTGTCAGATGTGGAACTTATCCCGTTGCCTTTAGAACCCCAAGTGAAAATTAGAGGAATAATTCCGGAAACAGCTACACTGTTTAAAAGTGCCCTTATGCCTGCACAGTTGTTTTTTAAGACGGAAGATGGAGGCAAATATCCAGTTATATTTAAGCATGGAGATGATTTACGTCAAGATCAACTTATTCTTCAAATCATTTCACTCATGGACAAGCTGTTACGG

Ensembl | Número de adesão de ser humano

ENSG00000078142

nº de adesão NCBI

NM_002647

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... PIK3C3(5289) , PIK3C3(5289)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Pierre-Luc Mouchel et al.
Cancers, 12(10) (2020-10-16)
Dendrogenin A (DDA), a mammalian cholesterol metabolite with tumor suppressor properties, has recently been shown to exhibit strong anti-leukemic activity in acute myeloid leukemia (AML) cells by triggering lethal autophagy. Here, we demonstrated that DDA synergistically enhanced the toxicity of
Harilaos Filippakis et al.
Scientific reports, 8(1), 14161-14161 (2018-09-23)
Tuberous Sclerosis Complex (TSC), a rare genetic disorder with mechanistic target of rapamycin complex 1 (mTORC1) hyperactivation, is characterized by multi-organ hamartomatous benign tumors including brain, skin, kidney, and lung (Lymphangioleiomyomatosis). mTORC1 hyperactivation drives metabolic reprogramming including glucose and glutamine
Jian-Kang Chen et al.
The Journal of clinical investigation, 125(6), 2429-2444 (2015-05-20)
Kidney size adaptively increases as mammals grow and in response to the loss of 1 kidney. It is not clear how kidneys size themselves or if the processes that adapt kidney mass to lean body mass also mediate renal hypertrophy
María Cecilia Gimenez et al.
Journal of virology, 95(6) (2020-12-29)
Infectious bursal disease virus (IBDV) is the archetypal member of the family Birnaviridae and the etiological agent of Gumboro disease, a highly contagious immunosuppressive infection of concern to the global poultry sector for its adverse health effects in chicks. Unlike
Asma Boukhalfa et al.
Nature communications, 11(1), 294-294 (2020-01-17)
Cells subjected to stress situations mobilize specific membranes and proteins to initiate autophagy. Phosphatidylinositol-3-phosphate (PI3P), a crucial lipid in membrane dynamics, is known to be essential in this context. In addition to nutriments deprivation, autophagy is also triggered by fluid-flow
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica