Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU041301

Sigma-Aldrich

MISSION® esiRNA

targeting human CD9

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TTGGACTATGGCTCCGATTCGACTCTCAGACCAAGAGCATCTTCGAGCAAGAAACTAATAATAATAATTCCAGCTTCTACACAGGAGTCTATATTCTGATCGGAGCCGGCGCCCTCATGATGCTGGTGGGCTTCCTGGGCTGCTGCGGGGCTGTGCAGGAGTCCCAGTGCATGCTGGGACTGTTCTTCGGCTTCCTCTTGGTGATATTCGCCATTGAAATAGCTGCGGCCATCTGGGGATATTCCCACAAGGATGAGGTGATTAAGGAAGTCCAGGAGTTTTACAAGGACACCTACAACAAGCTGAAAACCAAGGATGAGCCCCAGCGGGAAACGCTGAAAGCCATCCACTATGCGTTGAACTGCTGTGGTTTGGCTGGGGGCGTGGAACAGTTTATCTCAGACATCTGCCCCAAGAAGGACGTACTCGAAACCTTCACCGTGAAGTCCTGTCCTGATGCCATC

Ensembl | Número de adesão de ser humano

ENSG00000010278

nº de adesão NCBI

NM_001769

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... CD9(928) , CD9(928)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
QCS
ZWT
MIT
TTS
FAS

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Joshua S Brzozowski et al.
Scientific reports, 8(1), 8822-8822 (2018-06-13)
To facilitate intercellular communication, cells release nano-sized, extracellular vesicles (EVs) to transfer biological cargo to both local and distant sites. EVs are enriched in tetraspanins, two of which (CD9 and CD151) have altered expression patterns in many solid tumours, including
Yuichiro Miki et al.
British journal of cancer, 118(6), 867-877 (2018-02-14)
This corrects the article DOI: 10.1038/bjc.2017.85.
Jung Hee Cho et al.
Cell death and differentiation, 27(9), 2681-2696 (2020-04-30)
CD9, a 24 kDa tetraspanin membrane protein, is known to regulate cell adhesion and migration, cancer progression and metastasis, immune and allergic responses, and viral infection. CD9 is upregulated in senescent endothelial cells, neointima hyperplasia, and atherosclerotic plaques. However, its role
Soonyean Hwang et al.
Cellular and molecular life sciences : CMLS, 76(8), 1595-1604 (2019-02-20)
Tetraspanin protein CD151 has typically been studied as binding partner and functional regulator of laminin-binding integrins. However, we show here that CD151 supports anti-cancer drug resistance independent of integrins. CD151 ablation sensitized multiple tumor cell types to several anti-cancer drugs
Michael J Herr et al.
PloS one, 9(9), e106999-e106999 (2014-09-04)
The most prevalent cardiovascular diseases arise from alterations in vascular smooth muscle cell (VSMC) morphology and function. Tetraspanin CD9 has been previously implicated in regulating vascular pathologies; however, insight into how CD9 may regulate adverse VSMC phenotypes has not been
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica