Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU041011

Sigma-Aldrich

MISSION® esiRNA

targeting human HPSE

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TTTGCAGCTGGCTTTATGTGGCTGGATAAATTGGGCCTGTCAGCCCGAATGGGAATAGAAGTGGTGATGAGGCAAGTATTCTTTGGAGCAGGAAACTACCATTTAGTGGATGAAAACTTCGATCCTTTACCTGATTATTGGCTATCTCTTCTGTTCAAGAAATTGGTGGGCACCAAGGTGTTAATGGCAAGCGTGCAAGGTTCAAAGAGAAGGAAGCTTCGAGTATACCTTCATTGCACAAACACTGACAATCCAAGGTATAAAGAAGGAGATTTAACTCTGTATGCCATAAACCTCCATAATGTCACCAAGTACTTGCGGTTACCCTATCCTTTTTCTAACAAGCAAGTGGATAAATACCTTCTAAGACCTTTGGGACCTCATGGATTACTTTCCAAATCTGTCCAACTCAATGGTCTAACTCTAAAGATGGTGGATGATCAAACCTTGCCACCTTTAATGGAA

Ensembl | Número de adesão de ser humano

ENSG00000173083

nº de adesão NCBI

NM_006665

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... HPSE(10855) , HPSE(10855)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
LIS
WAS

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Marjolein Garsen et al.
The American journal of pathology, 186(4), 805-815 (2016-02-14)
Heparanase, a heparan sulfate (HS)--specific endoglucuronidase, mediates the onset of proteinuria and renal damage during experimental diabetic nephropathy. Glomerular heparanase expression is increased in most proteinuric diseases. Herein, we evaluated the role of heparanase in two models of experimental glomerulonephritis
Jianping Li et al.
American journal of cancer research, 7(2), 234-244 (2017-03-25)
Heparanase (HPSE1) is elevated in various types of cancers including cervical cancer, and correlated with poor prognosis. Current study is to investigate the effects of HPSE1 on radiation response in cervical cancer. Colony formation assays after radiation were performed to
Uri Barash et al.
International journal of cancer, 145(6), 1596-1608 (2019-04-30)
Heparanase is an endo-β-d-glucuronidase that cleaves heparan sulfate (HS) side chains of heparan sulfate proteoglycans. Compelling evidence tie heparanase levels with all steps of tumor formation including tumor initiation, growth, metastasis and chemo-resistance, likely involving augmentation of signaling pathways and
Haiyan Zheng et al.
Cancer biomarkers : section A of Disease markers, 15(5), 525-534 (2015-01-15)
Heparanase(HPSE), an endo-β -D-glucuronidase, is found overexpressed in Ovarian cancer (OC). The purpose of our work was to investigate primitively the possible role of HPSE in the development of OC. In this study, RNA interference (RNAi) with a HPSE small
Satvik R Hadigal et al.
Nature communications, 6, 6985-6985 (2015-04-29)
Herpesviruses exemplified by herpes simplex virus-1 (HSV-1) attach to cell surface heparan sulfate (HS) for entry into host cells. However, during a productive infection, the HS moieties on parent cells can trap newly exiting viral progenies and inhibit their release.

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica