Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU039821

Sigma-Aldrich

MISSION® esiRNA

targeting human LGR5

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CCACTCCCTGGGAAAGAAATGCTTTGATGGGCTCCACAGCCTAGAGACTTTAGATTTAAATTACAATAACCTTGATGAATTCCCCACTGCAATTAGGACACTCTCCAACCTTAAAGAACTAGGATTTCATAGCAACAATATCAGGTCGATACCTGAGAAAGCATTTGTAGGCAACCCTTCTCTTATTACAATACATTTCTATGACAATCCCATCCAGTTTGTTGGGAGATCTGCTTTTCAACATTTACCTGAACTAAGAACACTGACTCTGAATGGTGCCTCACAAATAACTGAATTTCCTGATTTAACTGGAACTGCAAACCTGGAGAGTCTGACTTTAACTGGAGCACAGATCTCATCTCTTCCTCAAACCGTCTGCAATCAGTTACCTAATCTCCAAGTGCTAGATCTGTCTTACAACCTATTAGAAGATTTACCCAGTTTTTCAGTCTGCCAAAAGCTTCA

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Xiangfei Wang et al.
Oncogenesis, 7(8), 57-57 (2018-08-10)
LGR5 plays a critical role in tissue development and the maintenance of adult stem cells in gastrointestinal tract. However, the oncogenic role of LGR5 in the development of gastric adenocarcinoma remains elusive. Here, we show that LGR5 promotes gastric adenocarcinoma
Bo Gun Jang et al.
The American journal of pathology, 188(10), 2236-2250 (2018-07-24)
We investigated the expression profile of leucine-rich, repeat-containing, G-protein-coupled receptor 5 (LGR5) during colorectal cancer (CRC) progression and determined the prognostic impact of LGR5 in a large cohort of CRC samples. LGR5 expression was higher in CRCs than in normal
Lalarukh Haris Shaikh et al.
The Journal of clinical endocrinology and metabolism, 100(6), E836-E844 (2015-04-29)
Aldosterone synthesis and cellularity in the human adrenal zona glomerulosa (ZG) is sparse and patchy, presumably due to salt excess. The frequency of somatic mutations causing aldosterone-producing adenomas (APAs) may be a consequence of protection from cell loss by constitutive

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica