Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU039471

Sigma-Aldrich

MISSION® esiRNA

targeting human NBN

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

TATGCTCCAAAGGCAAGGTCTTAGACCTATTCCTGAAGCAGAAATTGGATTGGCGGTGATTTTCATGACTACAAAGAATTACTGTGATCCTCAGGGCCATCCCAGTACAGGATTAAAGACAACAACTCCAGGACCAAGCCTTTCACAAGGCGTGTCAGTTGATGAAAAACTAATGCCAAGCGCCCCAGTGAACACTACAACATACGTAGCTGACACAGAATCAGAGCAAGCAGATACATGGGATTTGAGTGAAAGGCCAAAAGAAATCAAAGTCTCCAAAATGGAACAAAAATTCAGAATGCTTTCACAAGATGCACCCACTGTAAAGGAGTCCTGCAAAACAAGCTCTAATAATAATAGTATGGTATCAAATACTTTGGCTAAGATGAGAATCCCAAACTATCAGCTTTCACCAACTAAATTGCCAAGTATAAATAAAAGTAAAGATAGGGCTTCTCAGCAGCAG

Ensembl | Número de adesão de ser humano

ENSG00000104320

nº de adesão NCBI

NM_002485

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... NBN(4683) , NBN(4683)

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Katie Myers et al.
PLoS genetics, 5(1), e1000324-e1000324 (2009-01-03)
The related PIK-like kinases Ataxia-Telangiectasia Mutated (ATM) and ATM- and Rad3-related (ATR) play major roles in the regulation of cellular responses to DNA damage or replication stress. The pro-apoptotic role of ATM and p53 in response to ionizing radiation (IR)
Artem K Velichko et al.
Nucleic acids research, 47(13), 6811-6825 (2019-05-23)
The contribution of nucleoli to the cellular stress response has been discussed for over a decade. Stress-induced inhibition of RNA polymerase I-dependent transcription is hypothesized as a possible effector program in such a response. In this study, we report a
Daniel C Anacker et al.
Journal of virology, 88(15), 8528-8544 (2014-05-23)
Activation of the ATM (ataxia telangiectasia-mutated kinase)-dependent DNA damage response (DDR) is necessary for productive replication of human papillomavirus 31 (HPV31). We previously found that DNA repair and homologous recombination (HR) factors localize to sites of HPV replication, suggesting that

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica