Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU037241

Sigma-Aldrich

MISSION® esiRNA

targeting human SMAD3

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GGCTTTGAGGCTGTCTACCAGTTGACCCGAATGTGCACCATCCGCATGAGCTTCGTCAAAGGCTGGGGAGCGGAGTACAGGAGACAGACTGTGACCAGTACCCCCTGCTGGATTGAGCTGCACCTGAATGGGCCTTTGCAGTGGCTTGACAAGGTCCTCACCCAGATGGGCTCCCCAAGCATCCGCTGTTCCAGTGTGTCTTAGAGACATCAAGTATGGTAGGGGAGGGCAGGCTTGGGGAAAATGGCCATGCAGGAGGTGGAGAAAATTGGAACTCTACTCAACCCATTGTTGTCAAGGAAGAAGAAATCTTTCTCCCTCAACTGAAGGGGTGCACCCACCTGTTTTCTGAAACACACGAGCAAACCCAGAGGTGGATGTTATGAACAGCTGTGTCTGCCAAACACATTTACCCTTTGGCCCCACTTTGAAGGGCAAGAAATGGCGTCTGCTCTGGTGGCTTAAGTGA

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Nao Hiwatashi et al.
The Laryngoscope, 127(9), E308-E316 (2017-05-26)
Recent reports highlight the efficacy of small interfering RNA (siRNA) targeting SMAD3 to regulate transforming growth factor β (TGF-β)-mediated fibroplasia in vocal fold fibroblasts. The current study sought to investigate SMAD3 expression during wound healing in vivo and quantify the
Zheng Jiang et al.
Journal of biochemistry, 165(4), 317-322 (2018-12-12)
Radiotherapy is the major treatment modality for malignant glioma. However, the treatment response of radiotherapy is suboptimal due to resistance. Here we aimed to explore the effect and mechanism of Mothers against decapentaplegic homologue (SMAD3) silencing in sensitizing malignant glioma
Meaghan H Hancock et al.
Cell host & microbe, 27(1), 104-114 (2019-12-24)
Infection with human cytomegalovirus (HCMV) remains a significant cause of morbidity and mortality following hematopoietic stem cell transplant (HSCT) because of various hematologic problems, including myelosuppression. Here, we demonstrate that latently expressed HCMV miR-US5-2 downregulates the transcriptional repressor NGFI-A binding protein (NAB1) to induce
Ayesha Ghayur et al.
American journal of physiology. Renal physiology, 317(1), F152-F162 (2019-05-30)
Glomerulonephritis (GN) is a common cause of end-stage kidney disease and is characterized by glomerular inflammation, hematuria, proteinuria, and progressive renal dysfunction. Transforming growth factor (TGF)-β is involved in glomerulosclerosis and interstitial fibrosis. TGF-β activates multiple signaling pathways, including the
S Muppala et al.
Oncogene, 36(36), 5189-5198 (2017-05-10)
TGF-β is a multifunctional cytokine affecting many cell types and implicated in tissue remodeling processes. Due to its many functions and cell-specific effects, the consequences of TGF-β signaling are process-and stage-dependent, and it is not uncommon that TGF-β exerts distinct

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica