Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU033071

Sigma-Aldrich

MISSION® esiRNA

targeting human CDK6

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

TGTTTCAGCTTCTCCGAGGTCTGGACTTTCTTCATTCACACCGAGTAGTGCATCGCGATCTAAAACCACAGAACATTCTGGTGACCAGCAGCGGACAAATAAAACTCGCTGACTTCGGCCTTGCCCGCATCTATAGTTTCCAGATGGCTCTAACCTCAGTGGTCGTCACGCTGTGGTACAGAGCACCCGAAGTCTTGCTCCAGTCCAGCTACGCCACCCCCGTGGATCTCTGGAGTGTTGGCTGCATATTTGCAGAAATGTTTCGTAGAAAGCCTCTTTTTCGTGGAAGTTCAGATGTTGATCAACTAGGAAAAATCTTGGACGTGATTGGACTCCCAGGAGAAGAAGACTGGCCTAGAGATGTTGCCCTTCCCAGGCAGGCTTTTCATTCAAAATCTGCCCAACCAATTGAG

Ensembl | Número de adesão de ser humano

ENSG00000105810

nº de adesão NCBI

NM_001259

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... CDK6(1021) , CDK6(1021)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Míriam Tarrado-Castellarnau et al.
Molecular systems biology, 13(10), 940-940 (2017-10-06)
Cyclin-dependent kinases (CDK) are rational cancer therapeutic targets fraught with the development of acquired resistance by tumor cells. Through metabolic and transcriptomic analyses, we show that the inhibition of CDK4/6 leads to a metabolic reprogramming associated with gene networks orchestrated
Lihua Guo et al.
Journal of B.U.ON. : official journal of the Balkan Union of Oncology, 23(3), 787-794 (2018-07-14)
Clear cell renal cell carcinoma (ccRCC) accounts for 70-80% of renal cell carcinomas. Various microRNAs (miRs) have been reported to affect the tumorigenesis of ccRCC. However, the role of miR-384 in ccRCC is still unknown. Thus, the purpose of this
Xuefeng Pan et al.
Molecular therapy. Nucleic acids, 22, 38-49 (2020-09-11)
Emerging studies indicate that long noncoding RNAs (lncRNAs) play crucial roles in ovarian cancer (OC). By analyzing high-throughput data, we found that SNHG17 was highly expressed in multiple OC cohorts. However, its functions in OC were not explored. In this
Liam Cornell et al.
Cell reports, 26(10), 2667-2680 (2019-03-07)
CDK4/6 inhibition is now part of the standard armamentarium for patients with estrogen receptor-positive (ER+) breast cancer, so that defining mechanisms of resistance is a pressing issue. Here, we identify increased CDK6 expression as a key determinant of acquired resistance
Tongzheng Liu et al.
Nature communications, 8, 13923-13923 (2017-01-10)
Tumour metastasis, the spread of cancer cells from the original tumour site followed by growth of secondary tumours at distant organs, is the primary cause of cancer-related deaths and remains poorly understood. Here we demonstrate that inhibition of CDK4/6 blocks
Exibir todos os documentos relacionados

Protocolos

Coronavirus qPCR Design Case Study & Related Products to Support SARS-CoV-2 Research

Coronavirus qPCR Primer and probe sets for the detection of SARS-CoV-2 (Corona Virus), with additional real-time RT-PCR, RT-qPCR and supporting reagents available.

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica