Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU032631

Sigma-Aldrich

MISSION® esiRNA

targeting human DCTN4

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CAAGAAACTGGCACGACGTAGAAACTATATGCCTCTGGCTTTTTCGGACAAATATGGTCTTGGAACCAGGCTTCAGCGACCACGAGCTGGTGCATCCATCAGTACCCTTGCCGGACTTTCCCTTAAAGAAGGAGAGGATCAGAAAGAGATAAAGATTGAGCCAGCTCAGGCTGTGGATGAAGTGGAACCTCTACCTGAAGACTATTATACAAGACCAGTAAATTTAACAGAGGTAACAACCCTTCAGCAGCGTCTGTTACAGCCTGACTTCCAGCCAGTCTGTGCTTCACAGCTCTATCCTCGCCACAAACATCTTCTGATCAAACGGTCCCTGCGCTGCCGTAAATGTGAACATAATTTGAGCAAGCCAGAATTTAACCCAACGTCAATCAAATTCAAAATCCAGCTGGTCG

Ensembl | Número de adesão de ser humano

ENSG00000132912

nº de adesão NCBI

NM_016221

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... DCTN4(51164) , DCTN4(51164)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Lamentamos, não temos COA para este produto disponíveis online no momento.

Se precisar de ajuda, entre em contato Atendimento ao cliente

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Leticia M Ignacio-Souza et al.
Endocrinology, 155(8), 2831-2844 (2014-06-04)
In both human and experimental obesity, inflammatory damage to the hypothalamus plays an important role in the loss of the coordinated control of food intake and energy expenditure. Upon prolonged maintenance of increased body mass, the brain changes the defended
Kaori Kojima et al.
Neuroscience letters, 581, 37-41 (2014-08-26)
p62, which is also called sequestosome 1 (SQSTM1), plays a critical role in neuronal cell death. However, the role of p62 in axonal degeneration remains unclear. We evaluated whether the modulation of p62 expression may affect axonal loss in tumor
Young-Ok Son et al.
The Journal of biological chemistry, 289(41), 28660-28675 (2014-08-27)
The cadmium-transformed human lung bronchial epithelial BEAS-2B cells exhibit a property of apoptosis resistance as compared with normal non-transformed BEAS-2B cells. The level of basal reactive oxygen species (ROS) is extremely low in transformed cells in correlation with elevated expressions
Young-Ok Son et al.
The Journal of biological chemistry, 290(45), 27090-27100 (2015-09-20)
Arsenic (As(3+)) is a carcinogen with considerable environmental and occupational relevancy. The present study shows that As(3+)-transformed human lung bronchial epithelial BEAS-2B cells (AsT cells) exhibit the property of apoptosis resistance. The level of basal reactive oxygen species (ROS) is
Ashwani Khurana et al.
Oncotarget, 6(34), 36354-36369 (2015-10-27)
A promising new strategy for cancer therapy is to target the autophagic pathway. In the current study, we demonstrate that the antimalarial drug Quinacrine (QC) reduces cell viability and promotes chemotherapy-induced cell death in an autophagy-dependent manner more extensively in

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica