Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU031671

Sigma-Aldrich

MISSION® esiRNA

targeting human CD81

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GCTGTCATGATGTTCGTTGGCTTCCTGGGCTGCTACGGGGCCATCCAGGAATCCCAGTGCCTGCTGGGGACGTTCTTCACCTGCCTGGTCATCCTGTTTGCCTGTGAGGTGGCCGCCGGCATCTGGGGCTTTGTCAACAAGGACCAGATCGCCAAGGATGTGAAGCAGTTCTATGACCAGGCCCTACAGCAGGCCGTGGTGGATGATGACGCCAACAACGCCAAGGCTGTGGTGAAGACCTTCCACGAGACGCTTGACTGCTGTGGCTCCAGCACACTGACTGCTTTGACCACCTCAGTGCTCAAGAACAATTTGTGTCCCTCGGGCAGCAACATCATCAGCAACCTCTTCAAGGAGGACTGCCACCAGAAGATCGATGACCTCTTCTCCGGGAAGCTGTACCTCATCGGCAT

Ensembl | Número de adesão de ser humano

ENSG00000110651

nº de adesão NCBI

NM_004356

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... CD81(975) , CD81(975)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
HDV
PJT
DOR

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Down-regulation of CD81 in human cells producing HCV-E1/E2 retroVLPs.
Ana F Rodrigues et al.
BMC proceedings, 5 Suppl 8, P72-P72 (2012-03-01)
Raphaël Gaudin et al.
PloS one, 8(7), e69450-e69450 (2013-08-08)
During HIV pathogenesis, infected macrophages behave as "viral reservoirs" that accumulate and retain virions within dedicated internal Virus-Containing Compartments (VCCs). The nature of VCCs remains ill characterized and controversial. Using wild-type HIV-1 and a replication-competent HIV-1 carrying GFP internal to
Zhen-yong Keck et al.
PLoS pathogens, 8(4), e1002653-e1002653 (2012-04-19)
The majority of broadly neutralizing antibodies to hepatitis C virus (HCV) are against conformational epitopes on the E2 glycoprotein. Many of them recognize overlapping epitopes in a cluster, designated as antigenic domain B, that contains residues G530 and D535. To
Chien-Te K Tseng et al.
The Journal of experimental medicine, 195(1), 43-49 (2002-01-10)
Infection with hepatitis C virus (HCV) is a leading cause of chronic liver disease worldwide. Little is known about how this virus is able to persist or whether this persistence might be because of its ability to alter the early
Zhihui Chen et al.
PloS one, 6(4), e18933-e18933 (2011-04-29)
HCV infection is often associated with B-cell regulatory control disturbance and delayed appearance of neutralizing antibodies. CD81 is a cellular receptor for HCV and can bind to HCV envelope protein 2 (E2). CD81 also participates to form a B cell
Exibir todos os documentos relacionados

Global Trade Item Number

SKUGTIN
EHU031671-50UG4061828345311
EHU031671-20UG4061831350838

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica