Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU031131

Sigma-Aldrich

MISSION® esiRNA

targeting human SUB1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

TCAAGCTCTTCTGGCAGTGATTCTGACAGTGAGGTTGACAAAAAGTTAAAGAGGAAAAAGCAAGTTGCTCCAGAAAAACCTGTAAAGAAACAAAAGACAGGTGAGACTTCGAGAGCCCTGTCATCTTCTAAACAGAGCAGCAGCAGCAGAGATGATAACATGTTTCAGATTGGGAAAATGAGGTACGTTAGTGTTCGCGATTTTAAAGGCAAAGTGCTAATTGATATTAGAGAATATTGGATGGATCCTGAAGGTGAAATGAAACCAGGAAGAAAAGGTATTTCTTTAAATCCAGAACAATGGAGCCAGCTGAAGGAACAGATTTCTGACATTGATGATGCAGTAAGAAAACTGTAAAATTCGAGCCATATAAATAAAACCTGTACTGTTCTAGTTGTTTTAATCTGTCTTTTTACATTGGCTTTTGTTTTCTAAATGTTCTCCAAGCTATTGTATGTTTGGATTGCAGAAGAATTTG

Ensembl | Número de adesão de ser humano

ENSG00000113387

nº de adesão NCBI

NM_006713

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... SUB1(10923) , SUB1(10923)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

B V S K Chakravarthi et al.
Oncogene, 35(49), 6330-6340 (2016-06-09)
MicroRNA-101, a tumor suppressor microRNA (miR), is often downregulated in cancer and is known to target multiple oncogenes. Some of the genes that are negatively regulated by miR-101 expression include histone methyltransferase EZH2 (enhancer of zeste homolog 2), COX2 (cyclooxygenase-2)
Shaolin Tao et al.
American journal of cancer research, 5(6), 1878-1889 (2015-08-14)
Human transcriptional positive cofactor 4 (PC4) is a novel marker for diagnosis and treatment of advanced human cancers metastasis. In human lung adenocarcinoma, tumor lymphangiogenesis, an important early event, can promotes lymphatic metastasis, while it has been reported that VEGF-C/VEGF-D/VEGFR-3
Shin-Hee Heo et al.
Cancer letters, 362(1), 139-148 (2015-04-02)
All-trans retinoic acid (ATRA), the most biologically active metabolite of vitamin A, has been extensively studied for the prevention and treatment of cancer; however, the underlying mechanism of its anti-cancer potential is still unclear. Here we found that ATRA induces
Young Lan Seo et al.
The Journal of general virology, 96(Pt 4), 822-832 (2014-12-24)
Infection with hepatitis C virus (HCV) is characterized by systemic oxidative stress that is caused by either viral core protein or chronic inflammation. It is well recognized that reactive oxygen species (ROS) such as H2O2 can induce apoptotic cell death

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica