Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU030131

Sigma-Aldrich

MISSION® esiRNA

targeting human ROCK2

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

ATTCTGAGCAACTGGCTCGTTCAATTGCTGAAGAACAATATTCTGATTTGGAAAAAGAGAAGATCATGAAAGAGCTGGAGATCAAAGAGATGATGGCTAGACACAAACAGGAACTTACGGAAAAAGATGCTACAATTGCTTCTCTTGAGGAAACTAATAGGACACTAACTAGTGATGTTGCCAATCTTGCAAATGAGAAAGAAGAATTAAATAACAAATTGAAAGATGTTCAAGAGCAACTGTCAAGATTGAAAGATGAAGAAATAAGCGCAGCAGCTATTAAAGCACAGTTTGAGAAGCAGCTATTAACAGAAAGAACACTCAAAACTCAAGCTGTGAATAAGTTGGCTGAGATCATGAATCGAAAAGAACCTGTCAAGCGTGGTAATGACACAGATGTGCGGAGAAAAGAGAAGGAGAATAGAAAGCTACATATGGAGCTTAAATCTGAACGTGAGAAATTGACCCAGCAGATGATCAAG

Ensembl | Número de adesão de ser humano

ENSG00000134318

nº de adesão NCBI

NM_004850

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... ROCK2(9475) , ROCK2(9475)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Sarah Theresa Boyle et al.
Nature cell biology, 22(7), 882-895 (2020-05-27)
It is well accepted that cancers co-opt the microenvironment for their growth. However, the molecular mechanisms that underlie cancer-microenvironment interactions are still poorly defined. Here, we show that Rho-associated kinase (ROCK) in the mammary tumour epithelium selectively actuates protein-kinase-R-like endoplasmic
Ying-Ting Zhu et al.
The Journal of cell biology, 206(6), 799-811 (2014-09-10)
Currently there are limited treatment options for corneal blindness caused by dysfunctional corneal endothelial cells. The primary treatment involves transplantation of healthy donor human corneal endothelial cells, but a global shortage of donor corneas necessitates other options. Conventional tissue approaches
Ming-Ming Ma et al.
British journal of pharmacology, 173(3), 529-544 (2015-11-13)
Angiotensin II (AngII) induces migration and growth of vascular smooth muscle cell (VSMC), which is responsible for vascular remodelling in some cardiovascular diseases. Ang II also activates a Cl(-) current, but the underlying mechanism is not clear. The A10 cell
Ye Wang et al.
PloS one, 11(1), e0146646-e0146646 (2016-01-09)
Some recent studies suggest that multiple miRNAs might regulate neurogenic transdifferentiation of mesenchymal stromal cells (MSCs). In the present study, we hypothesized that the miR-124 can repress the expression of RhoA upon the neurogenesis of adipose derived MSCs (ADMSCs). MiRNA
Clarissa N Amaya et al.
BMC cancer, 17(1), 485-485 (2017-07-16)
The serine/threonine protein kinases ROCK1 and 2 are key RhoA-mediated regulators of cell shape and cytoskeletal dynamics. These proteins perform multiple functions in vascular endothelial cell physiology and are attractive targets for cancer therapy based on their roles as oncogenes
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica