Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU029771

Sigma-Aldrich

MISSION® esiRNA

targeting human MYD88

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

TGCAGAGCAAGGAATGTGACTTCCAGACCAAATTTGCACTCAGCCTCTCTCCAGGTGCCCATCAGAAGCGACTGATCCCCATCAAGTACAAGGCAATGAAGAAAGAGTTCCCCAGCATCCTGAGGTTCATCACTGTCTGCGACTACACCAACCCCTGCACCAAATCTTGGTTCTGGACTCGCCTTGCCAAGGCCTTGTCCCTGCCCTGAAGACTGTTCTGAGGCCCTGGGTGTGTGTGTATCTGTCTGCCTGTCCATGTACTTCTGCCCTGCCTCCTCCTTTCGTTGTAGGAGGAATCTGTGCTCTACTTACCTCTCAATTCCTGGAGATGCCAACTTCACAGACACGTCTGCAGCAGCTGGACATCACATTTCATGTCCTGCATGGAACCAGTGGCTGTGAGTGGCATGTCCACTTGCTGGATTATCAGCCAGGACACTATAGAACAGGACCAGCTGAGACTAAGAAGGACCAGCAGAGCC

Ensembl | Número de adesão de ser humano

ENSG00000172936

nº de adesão NCBI

NM_002468

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... MYD88(4615) , MYD88(4615)

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Michele Cea et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 22(24), 6099-6109 (2016-06-12)
Nicotinamide phosphoribosyltransferase (Nampt) regulates intracellular NAD We investigated Nampt role in MW cells using both mRNA and protein expression analyses. We have also used loss-of-function approaches to investigate the growth and survival effects of Nampt on MW cells and further
Lingyu Zhang et al.
Gene, 700, 85-95 (2019-03-18)
MiR-155-3p, which is derived from the same pre-miRNA as miR-155-5p, the latter has been reported to be dysregulated in multiple tumor tissues and associated with clinicopathologic markers, tumor subtypes, and poor survival rates. However, the biological effects of miR-155-3p are
Xin Wen et al.
Journal of cellular physiology, 233(9), 7022-7034 (2018-01-31)
Epilepsy is a group of neurological disorders characterized by epileptic seizures. In this study, we aim to explore the role of microRNA-421 (miR-421) in hippocampal neurons of epilepsy mice via the TLR/MYD88 pathway. Forty mice were randomly served as the

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica