Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU029261

Sigma-Aldrich

MISSION® esiRNA

targeting human FANCD2

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TCCGACTTGACCCAAACTTCCTATTGAAGGTTCGCCAGTTGGTGATGGATAAGTTGTCGTCTATTAGATTGGAGGATTTACCTGTGATAATAAAGTTCATTCTTCATTCCGTAACAGCCATGGATACACTTGAGGTAATTTCTGAGCTTCGGGAGAAGTTGGATCTGCAGCATTGTGTTTTGCCATCACGGTTACAGGCTTCCCAAGTAAAGTTGAAAAGTAAAGGACGAGCAAGTTCCTCAGGAAATCAAGAAAGCAGCGGTCAGAGCTGTATTATTCTCCTCTTTGATGTAATAAAGTCAGCTATTAGATATGAGAAAACCATTTCAGAAGCCTGGATTAAGGCAATTGAAAACACTGCCTCAGTATCTGAACACAAGGTGTTTGACCTGGTGATGCTTTTCATCATCTATAGCACCAATACTCAGACAAAGAAGTACATTGACAGGGTGCTAAGAAATAAGATTCGATCAGGCTGCATT

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Jian Chen et al.
Hepatology (Baltimore, Md.), 65(2), 678-693 (2017-01-24)
Exposure to genotoxins such as ethanol-derived acetaldehyde leads to DNA damage and liver injury and promotes the development of cancer. We report here a major role for the transforming growth factor β/mothers against decapentaplegic homolog 3 adaptor β2-Spectrin (β2SP, gene
Anaid Benitez et al.
Molecular cell, 71(4), 621-628 (2018-07-31)
FANCA is a component of the Fanconi anemia (FA) core complex that activates DNA interstrand crosslink repair by monoubiquitination of FANCD2. Here, we report that purified FANCA protein catalyzes bidirectional single-strand annealing (SA) and strand exchange (SE) at a level
Min Peng et al.
The EMBO journal, 33(15), 1698-1712 (2014-06-27)
Several proteins in the BRCA-Fanconi anemia (FA) pathway, such as FANCJ, BRCA1, and FANCD2, interact with mismatch repair (MMR) pathway factors, but the significance of this link remains unknown. Unlike the BRCA-FA pathway, the MMR pathway is not essential for

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica