Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU027961

Sigma-Aldrich

MISSION® esiRNA

targeting human LRP6

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CCCATGCACCTGGTTCTACTTCAAGATGAGCTATCATGTGGAGAACCTCCAACATGTTCTCCTCAGCAGTTTACTTGTTTCACGGGGGAAATTGACTGTATCCCTGTGGCTTGGCGGTGCGATGGGTTTACTGAATGTGAAGACCACAGTGATGAACTCAATTGTCCTGTATGCTCAGAGTCCCAGTTCCAGTGTGCCAGTGGGCAGTGTATTGATGGTGCCCTCCGATGCAATGGAGATGCAAACTGCCAGGACAAATCAGATGAGAAGAACTGTGAAGTGCTTTGTTTAATTGATCAGTTCCGCTGTGCCAATGGTCAGTGCATTGGAAAGCACAAGAAGTGTGATCATAATGTGGATTGCAGTGACAAGTCAGATGAACTGGATTGTTATCCGACTGAAGAACCAGCACCACAG

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Xu Luo et al.
Neuroscience bulletin, 36(10), 1171-1181 (2020-06-21)
Neuronal apoptosis is one of the essential mechanisms of early brain injury after subarachnoid hemorrhage (SAH). Recently, HLY78 has been shown to inhibit apoptosis in tumor cells and embryonic cells caused by carbon ion radiation through activation of the Wnt/β-catenin
Jiaqi Xu et al.
Oncology letters, 14(5), 5638-5642 (2017-11-04)
The third member of the Dickkopf family (DKK-3), also known as reduced expression in immortalized cells (REIC), is a tumor suppressor present in a variety of tumor cells. Regarding the regulation of the Wnt/β-catenin signaling pathway, exogenous DKK-1 and DKK-2
Han Zhou et al.
JCI insight, 5(3) (2020-02-14)
Vascular inflammation is present in many cardiovascular diseases, and exogenous glucocorticoids have traditionally been used as a therapy to suppress inflammation. However, recent data have shown that endogenous glucocorticoids, acting through the endothelial glucocorticoid receptor, act as negative regulators of
Lei Wang et al.
Bone research, 6, 22-22 (2018-07-25)
Low-density lipoprotein receptor-related protein 6 (LRP6) is a co-receptor for Wnt signaling and can be recruited by multiple growth factors/hormones to their receptors facilitating intracellular signaling activation. The ligands that bind directly to LRP6 have not been identified. Here, we
Toshiaki Teratani et al.
The Journal of clinical investigation, 128(4), 1581-1596 (2018-03-20)
Incidence of nonalcoholic steatohepatitis (NASH), which is considered a hepatic manifestation of metabolic syndrome, has been increasing worldwide with the rise in obesity; however, its pathological mechanism is poorly understood. Here, we demonstrate that the hepatic expression of aortic carboxypeptidase-like

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica