Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU024601

Sigma-Aldrich

MISSION® esiRNA

targeting human MTDH

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TCACAGTTACCACCGAGCAACTTACAACCGCATCATTTCCTGTTGGTTCCAAGAAGAATAAAGGTGATTCTCATCTAAATGTTCAAGTTAGCAACTTTAAATCTGGAAAAGGAGATTCTACACTTCAGGTTTCTTCAGGATTGAATGAAAACCTCACTGTCAATGGAGGAGGCTGGAATGAAAAGTCTGTAAAACTCTCCTCACAGATCAGTGCAGGTGAGGAGAAGTGGAACTCCGTTTCACCTGCTTCTGCAGGAAAGAGGAAAACTGAGCCATCTGCCTGGAGTCAAGACACTGGAGATGCTAATACAAATGGAAAAGACTGGGGAAGGAGTTGGAGTGACCGTTCAATATTTTCTGGCATTGGGTCTACTGCTGAGCCAGTTTCTCAGTCTACCACTTCTGATTATCAGTGGGATGTTAGCCGTAATCAACCCTATATCGATGATGAATGGTCTGGGTTAAATGGTCTGTCTTCTGCTGATCCCA

Ensembl | Número de adesão de ser humano

ENSG00000147649

nº de adesão NCBI

NM_178812

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... MTDH(92140) , MTDH(92140)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
GZT
YJT
WQS
YFS
DOR

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Rongquan He et al.
American journal of translational research, 9(4), 1561-1579 (2017-05-05)
Recent studies found that metadherin (MTDH) played an essential role in hepatocellular carcinoma (HCC). Nevertheless, the exact function of MTDH in the pathogenesis of HCC was unclarified. In the present study, we aimed to investigate the clinical significance of MTDH
Yongfeng Zhang et al.
Molecular medicine reports, 18(3), 3099-3105 (2018-07-18)
MicroRNAs (miRNAs/miRs) serve important roles in regulating gene expression by directly binding to the 3'‑untranslated regions of target genes. Multiple miRNAs are dysregulated in retinoblastoma (RB) and their dysregulation is closely related to RB malignancy. Therefore, exploring the detailed roles
Dong Pan et al.
International journal of oncology, 54(6), 1955-1968 (2019-05-14)
Studies have rarely been conducted on the role of miRNAs in prostate cancer (PCa) cell progression by directly targeting MTDH, at least to the best of our knowledge. Thus, the present study aimed to identify miRNAs closely related with metadherin
Fan Yang et al.
OncoTargets and therapy, 12, 4415-4426 (2019-06-27)
Purpose: Several microRNAs (miRNAs) that are aberrantly expressed in glioblastoma multiforme (GBM) play a significant role in GBM formation and progression. The expression profile and functions of miR-559 in GBM remain unclear. Here, we quantified the expression and investigated the
Kensuke Suzuki et al.
Oncotarget, 8(39), 66098-66111 (2017-10-17)
Pancreatic ductal adenocarcinoma (PDAC) has a high metastatic potential. However, the mechanism of metastatic colonization in PDAC remains poorly understood. Metadherin (MTDH) has emerged in recent years as a crucial mediator of metastasis in several cancer types, although the biological
Exibir todos os documentos relacionados

Global Trade Item Number

SKUGTIN
EHU024601-20UG4061831349863
EHU024601-50UG4061828350353

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica