Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU024471

Sigma-Aldrich

MISSION® esiRNA

targeting human FADD

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GGCTCGTCAGCTCAAAGTCTCAGACACCAAGATCGACAGCATCGAGGACAGATACCCCCGCAACCTGACAGAGCGTGTGCGGGAGTCACTGAGAATCTGGAAGAACACAGAGAAGGAGAACGCAACAGTGGCCCACCTGGTGGGGGCTCTCAGGTCCTGCCAGATGAACCTGGTGGCTGACCTGGTACAAGAGGTTCAGCAGGCCCGTGACCTCCAGAACAGGAGTGGGGCCATGTCCCCGATGTCATGGAACTCAGACGCATCTACCTCCGAAGCGTCCTGATGGGCCGCTGCTTTGCGCTGGTGGACCACAGGCATCTACACAGCCTGGACTTTGGTTCTCTCCAGGAAGGTAGCCCAGCACTGTGAAGACCCAGCAGGAAGCCAGGCTGAGTGAGCCACAGACCACCTGCTTCTGA

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Christiana G Savva et al.
BMC cancer, 16, 279-279 (2016-04-22)
Acquired resistance towards apoptosis is a hallmark of cancer. Elimination of cells bearing activated oncogenes or stimulation of tumor suppressor mediators may provide a selection pressure to overcome resistance. KC-53 is a novel biyouyanagin analogue known to elicit strong anti-inflammatory
Shih-Wei Wang et al.
Molecular carcinogenesis, 57(7), 866-877 (2018-03-23)
Luteolin (3',4',5,7-tetrahydroxyflavone), which exists in fruits, vegetables, and medicinal herbs, is used in Chinese traditional medicine for treating various diseases, such as hypertension, inflammatory disorders, and cancer. However, the gene-regulatory role of luteolin in cancer prevention and therapy has not
Zongliang Lu et al.
International journal of oncology, 56(2), 439-447 (2020-01-03)
Ophiopogonin D' (OPD') is a natural compound extracted from Ophiopogon japonicus, which is a plant used in traditional Chinese medicine. Our previous study has indicated that OPD' exhibits antitumor activity against androgen‑independent prostate cancer (PCa), but the effects and the
Fangfang Cai et al.
Cell death & disease, 11(1), 33-33 (2020-01-18)
Hydrogen sulfide (H2S) is now widely considered the third endogenous gasotransmitter and plays critical roles in cancer biological processes. In this study, we demonstrate that 5-(4-hydroxyphenyl)-3H-1,2-dithiole-3-thione (ADT-OH), the most widely used moiety for synthesising slow-releasing H2S donors, induces melanoma cell
Liang-Jun Wang et al.
Biochemical pharmacology, 162, 154-168 (2018-11-11)
Albendazole (ABZ) is a microtubule-targeting anthelmintic that acts against a variety of human cancer cells, but the dependence of its cytotoxicity on non-mitotic effect remains elusive. Thus, we aimed to explore the mechanistic pathway underlying the cytotoxicity of ABZ in

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica