Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU024211

Sigma-Aldrich

MISSION® esiRNA

targeting human XDH

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

ATTTCCGCTGATGATGTTCCTGGGAGTAACATAACTGGAATTTGTAATGATGAGACAGTCTTTGCGAAGGATAAGGTTACTTGTGTTGGGCATATCATTGGTGCTGTGGTTGCTGACACCCCGGAACACACACAGAGAGCTGCCCAAGGGGTGAAAATCACCTATGAAGAACTACCAGCCATTATCACAATTGAGGATGCTATAAAGAACAACTCCTTTTATGGACCTGAGCTGAAGATCGAGAAAGGGGACCTAAAGAAGGGGTTTTCCGAAGCAGATAATGTTGTGTCAGGGGAGATATACATCGGTGGCCAAGAGCACTTCTACCTGGAGACTCACTGCACCATTGCTGTTCCAAAAGGCGAGGCAGGGGAGATGGAGCTCTTTGTGTCTACACAGAACACCATGAAGACCCAGAGC

Ensembl | Número de adesão de ser humano

ENSG00000158125

nº de adesão NCBI

NM_000379

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... XDH(7498) , XDH(7498)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

G-L Chen et al.
Oncogenesis, 6(9), e382-e382 (2017-09-26)
Xanthine dehydrogenase (XDH), a rate-limiting enzyme involved in purine metabolism, has an essential role in inflammatory cascades. Researchers have known for decades that XDH activity is decreased in some cancers, including hepatocellular carcinoma (HCC). However, the role of XDH in
Se-Hyun Oh et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(6), 7301-7314 (2019-03-13)
Hypercholesterolemia is reported to increase reactive oxygen species (ROS) and to promote breast cancer progression. ROS play an important role in tumor biology, and xanthine oxidase (XO) is an enzyme that generates ROS. The effects of febuxostat (FBX), an XO
Seon Min Woo et al.
Oncotarget, 8(63), 106672-106684 (2018-01-02)
Cathepsin G is a serine protease secreted from activated neutrophils, it has important roles in inflammation and immune response. Moreover, cathepsin G promotes tumor cell-cell adhesion and migration in cancer cells. In this study, we investigated whether inhibition of cathepsin
Haixia Xu et al.
Free radical biology & medicine, 139, 70-79 (2019-05-20)
The natural compound Alternol was shown to induce profound oxidative stress and apoptotic cell death preferentially in cancer cells. In this study, a comprehensive investigation was conducted to understand the mechanism for Alternol-induced ROS accumulation responsible for apoptotic cell death.

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica