Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU023471

Sigma-Aldrich

MISSION® esiRNA

targeting human NT5E

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CGGAAGGTTCCTGTAGTCCAGGCCTATGCTTTTGGCAAATACCTAGGCTATCTGAAGATCGAGTTTGATGAAAGAGGAAACGTCATCTCTTCCCATGGAAATCCCATTCTTCTAAACAGCAGCATTCCTGAAGATCCAAGCATAAAAGCAGACATTAACAAATGGAGGATAAAATTGGATAATTATTCTACCCAGGAATTAGGGAAAACAATTGTCTATCTGGATGGCTCCTCTCAATCATGCCGCTTTAGAGAATGCAACATGGGCAACCTGATTTGTGATGCAATGATTAACAACAACCTGAGACACACGGATGAAATGTTCTGGAACCACGTATCCATGTGCATTTTAAATGGAGGTGGTATCCGGTCGCCCATTGATGAACGCAACAATGGCACAATTACCTGGGAGAACCTGGCTGCTGTATTGCCCTTTGGAGGCACATTTGACCTAGTCCAGTTAAAAGGTTCCACCCTGAAGAAGGCCTTTGAGCAT

Ensembl | Número de adesão de ser humano

ENSG00000135318

nº de adesão NCBI

NM_002526

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... NT5E(4907) , NT5E(4907)

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Jaden S Lee et al.
Virulence, 11(1), 414-429 (2020-05-19)
Cell surface nucleotide-metabolizing enzyme, ectonucleotidase-CD73, has emerged as a central component of the cellular homeostatic-machinery that counterbalances the danger-molecule (extracellular-ATP)-driven proinflammatory response in immune cells. While the importance of CD73 in microbial host fitness and symbiosis is gradually being unraveled
Young Mun Jeong et al.
Cancers, 12(10) (2020-10-23)
CD73 is involved in tumor immune escape and promotes the growth and progression of cancer cells. The functional role of CD73 expression in papillary thyroid carcinoma (PTC) has not yet been established. In 511 patients with PTC, immunohistochemistry for CD73
Brett Verstak et al.
Journal of leukocyte biology, 96(3), 427-436 (2014-05-09)
TLRs act as sentinels in professional immune cells to detect and initiate the innate immune response to pathogen challenge. TLR4 is a widely expressed TLR, responsible for initiating potent immune responses to LPS. TRAM acts to bridge TLR4 with TRIF
Xiao-Yu Shi et al.
Asian Pacific journal of tropical medicine, 7(10), 787-791 (2014-08-19)
To explore the effect of Fibulin-5 expression on cell proliferation and invasion in human gastric cancer patients. Fibulin-5 expression was detected in 56 samples of surgically resected gastric cancer and paired noncancerous tissues using qRT-PCR and immunoblotting. Fibulin-5 was knocked
J K Liu et al.
Cell death and differentiation, 21(8), 1325-1339 (2014-05-17)
Glioblastoma is the most common primary intrinsic brain tumor and remains incurable despite maximal therapy. Glioblastomas display cellular hierarchies with self-renewing glioma-initiating cells (GICs) at the apex. To discover new GIC targets, we used in vivo delivery of phage display
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica