Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU021911

Sigma-Aldrich

MISSION® esiRNA

targeting human UCHL1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CTGTGGCACAATCGGACTTATTCACGCAGTGGCCAATAATCAAGACAAACTGGGATTTGAGGATGGATCAGTTCTGAAACAGTTTCTTTCTGAAACAGAGAAAATGTCCCCTGAAGACAGAGCAAAATGCTTTGAAAAGAATGAGGCCATACAGGCAGCCCATGATGCCGTGGCACAGGAAGGCCAATGTCGGGTAGATGACAAGGTGAATTTCCATTTTATTCTGTTTAACAACGTGGATGGCCACCTCTATGAACTTGATGGACGAATGCCTTTTCCGGTGAACCATGGCGCCAGTTCAGAGGACACCCTGCTGAAGGACGCTGCCAAGGTCTGCAGAGAATTCACCGAGCGTGAGCAAGGAGAAGTCCGCTTCTCTGCCGTGGCTCTCTGCAAGGCAGCCTAATGCTCTGTGGGAGGGAC

Ensembl | Número de adesão de ser humano

ENSG00000154277

nº de adesão NCBI

NM_004181

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... UCHL1(7345) , UCHL1(7345)

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Lamentamos, não temos COA para este produto disponíveis online no momento.

Se precisar de ajuda, entre em contato Atendimento ao cliente

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Yuyin Xu et al.
Experimental cell research, 382(2), 111463-111463 (2019-06-28)
Diabetic nephrology (DN) is attributed largely to the depletion of podocytes, which is closely associated to apoptosis. However, the complex mechanism of podocyte loss in DN pathogenesis remains unclear. Recently, necroptosis has emerged as an important cell death model in
Yanhong Luo et al.
Journal of cellular biochemistry, 119(1), 691-700 (2017-06-22)
As a de-ubiquitin enzyme, ubiquitin C-terminal hydrolase (UCH)-L1 has been shown to be overexpressed in several human cancers. However, the function of UCH-L1 in invasion of breast cancers is still unclear. Here we report that the expression of UCH-L1 is
Wenjuan Wang et al.
Molecular carcinogenesis, 55(9), 1329-1342 (2015-08-22)
Multidrug resistant (MDR) cancer cells overexpressing P-glycoprotein (P-gp) exhibit enhanced invasive/metastatic ability as compared with the sensitive cells. We aimed to clarify the mechanism underlying this observation and found that during the development of drug resistance to adriamycin in MCF7
Eun Young Seo et al.
The Journal of investigative dermatology, 137(8), 1757-1765 (2017-04-11)
Ubiquitin carboxyl-terminal hydrolase L1 (UCHL1) is involved in many signaling pathways via the ubiquitin-proteasome system. UCHL1 is expressed in the human skin and serves as a neuronal marker; however, its functions in melanogenesis remain unknown. Here, we investigated the role
Hongbo Gao et al.
Biochemical and biophysical research communications, 492(1), 96-102 (2017-08-15)
Skeletal muscles are dynamic tissues that possess regenerative abilities, which require multiple processes and regulatory factors. Ubiquitin C-Terminal Hydrolase L1 (UCHL1), which is primarily expressed in neuronal tissues, was upregulated in skeletal muscles in disease conditions but its functional role
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica